Correction of a Genetic Disease in Mouse via Use of CRISPR Cas9 Supplemental Information

Cell Stem Cell, volume 13Supplemental InformationCorrection of a Genetic Diseasein Mouse via Use of CRISPR-Cas9Yuxuan Wu, Dan Liang, Yinghua Wang, Meizhu Bai, Wei Tang, Shiming Bao, Zhiqiang Yan, Dangsheng Li, and Jinsong LiSupplementary Figures:Figure S1.CRISPR-Cas9-mediated gene correction in cataract mice through NHEJ-based gene editing, related to Figure 1 and Table1.(A) Reading frameshift mutation can be corrected by NHEJ-mediated nucleotide insertion (+1, in small letter) or deletion (-2 or –(2+3n)) at break site, thus restoring the correct open reading frame for the WT γC-crystallin.(B) A repaired mouse through NHEJ-mediated gene editing is free of cataracts, while the control heterogeneous mutant mouse (Crygc+/-) exhibits cataract phenotype. (C) Progeny with a repaired mouse via NHEJ-based insertion (matted with C57BL/6 WT mouse).(D) DNA sequencing analysis of progeny shows that 3 of 5 pups carrying the corrected allele transmitted from the repaired mouse with NHEJ-mediated one-base insertion (small letter represents the inserted nucleotide).Figure S2. CRISPR-Cas9-mediated gene correction in cataract mice with supplying an exogenous single-strand DNA oligo, related to Figure 1 and Table 1.(A) Schematic for gene correction via HDR induced by CRISPR-Cas9 system using an exogenous WT single-strand DNA oligo (Oligo-1) as a template. The nucleotide marked in green is deleted in mutant allele. sgRNA-4 targeting site is labeled in blue and the PAM is marked in red.(B) Outline of one-step correction of genetic defect in cataract mouse model. The hybrid F1 pups delivered from wild type female mice (B6D2F1) mated with Crygc-/-mice are all cataract. Upon microinjections of Cas9 mRNA, sgRNA-4 and exogenous oligo DNA into heterogeneous zygotes carrying mutant Crygc allele, some of theembryos develop to term with normal phenotype.(C) The sequences of Crygc gene of the mice carrying CRISPR-Cas9-induced gene modifications. Insertions are indicated with (+), deletions are indicated with (-). Small letters represent the inserted nucleotides.(D) The repaired mice after CRISPR-Cas9-mediated gene correction via NHEJ or HDR are free of cataracts.(E) Schematic for gene correction via HDR induced by CRISPR-Cas9 system using an exogenous DNA oligo (Oligo-2) harboring two synonymous mutations (highlighted with red underlines) as a template. The nucleotide marked in green is deleted in mutant allele. sgRNA-4 targeting site is labeled in blue and the PAM is marked in red.(F) The sequences of Crygc gene of the mice carrying CRISPR-Cas9-induced gene modifications. Insertions are indicated with (+), deletions are indicated with (-). The synonymous mutations are highlighted with red underline. Small letters present inserted nucleotides.(G) The repaired mouse carrying corrected Crygc allele harboring two mutations is free of cataract, while the eyes of the heterogeneous mutant mouse (Crygc+/-) exhibit cataract phenotype.(H) Histological analysis of lenses from WT and cured mice (6-weeks old). The cataract-free mice cured via HDR and NHEJ exhibit normal histological features. (I) Progeny with a repaired mouse via HDR-based correction using Oligo-2 as a template (matted with BALB/c WT mouse).(J) DNA sequencing analysis of progeny shows that 3 of 8 pups carrying the correct allele transmitted from the repaired mouse with a corrected allele harboring two synonymous mutations (highlighted with red underlines).Supplemental Tables:Table S1. CRISPR-Cas9-mediated gene editing in normal and mutant ESCs. Related to Figure 1 and Table 1.sgRNA E14 ESC clones m Crygc (Crygc+/-) ESC clonesCleavage at 1 Allele/Total Cleavage at 2Alleles/TotalCleavage at WTAllele/TotalCleavage atMutantAllele/TotalHDR-mediatedRepair/TotalsgRNA-1 4/36 0/36 0/36 10/36 7/36sgRNA-2 23/36 7/36 17/36 25/36 2/36sgRNA-3 3/36 0/36 0/36 7/36 5/36sgRNA-4 0/36 0/36 0/36 11/36 16/36sgRNA-5 4/36 26/36 27/36 26/36 0/36 Plasmids encoding Cas9 and each of 5 sgRNAs targeting WT or mutant allele of Crgyc gene were transfected into WT E14 ESCs or heterozygous mutant ESCs (termed m Crygc ESCs). For each targeting experiment, PCR products corresponding to the putative target region were amplified from 36 ESC clones and sequenced.Table S2. The off-target analysis in the repaired mice, related to Figure 1, Figure S1 and Figure S2.*: 14 consecutive nucleotides of identity to the authentic target sequence are highlighted with underlie. PAM is marked in red.Potential off-target sitesSequence* Mutated mice (Total) Gm19385 (XR_108168) CCACAAGCCCCAGTCCTGGAGAC 0 (12) E17Rik (XR_108157) ACCAGAGCCCCAGTCCTAACTCT 0 (12) Plod1 (NM_011122) TGGGCAGCCCCAGTCCTGGAGTG 0 (12) Rnf145 (NM_026338) CTTCTGTCCCCAGTCCTGGAAGC 0 (12) D21RIK (NM_026338) AAATCAGCCCCAGTCCTGGCAAC 0 (12) Prkce (NM_011104) CCCAGAGCCCCAGTCCCATGTCC 0 (12) Dnahc17 (NM_001167746)TACAACCAGCCAGTCCTGGA AGG 2 (12) Chd9 (NM_177224) AGAAGAGCCCCAGTCCTCTGAAG 0 (12) Herc2 (NM_010418)ZFP592 (NM_178707) CCCAGAGCCCCAGTCCTTGGATG GTGGGAGGCCCAGTCCTGGAAG 0 (12) 0 (12)Supplemental Experimental ProceduresAnimal use and careAll animal procedures were performed under the ethical guidelines of the Institute of Biochemistry and Cell Biology.Construction of CRISPR plasmidsThe Cas9 and sgRNA plasmid pX330 were got from Addgene (Addgene plasmid 42230). To add a selectable marker on the plasmid, the pX330 plasmid was digested with Not I and inserted with a CMV-mcherry-pA cassette amplified from pmCherry-C1 (Clontech). To add a T7 promoter on the pX330 plasmid for in vitro transcription, the T7 sequence was subcloned into the pX330 plasmid with Kpn I and Nco I. The sgRNA-1, -2, -3, -4 and -5 were synthesized, annealed and ligated to the pX330 plasmid which was digested with Bbs I (New England Biolabs). The sequences of designed sgRNAs were: CACCCTCAAGAGTACCGGCCTTCC (sgRNA-1-S), AAACGGAAGGCCGGTACTCTTGAG (sgRNA-1-A), CACCGAGTACCGGCCTTCCAGGAC (sgRNA-2-S), AAACGTCCTGGAAGGCCGGTACTC (sgRNA-2-A) CACCGAGCCCCAGTCCTGGAAGGC (sgRNA-3-S) AAACGCCTTCCAGGACTGGGGCTC (sgRNA-3-A) CACCTACAGAGCCCCAGTCCTGGA (sgRNA-4-S) AAACTCCAGGACTGGGGCTCTGTA (sgRNA-4-A) CACCTGCTGAGGCCTCAAGAGTAC (sgRNA-5-S) and AAACGTACTCTTGAGGCCTCAGCA (sgRNA-5-S).Derivation of Crygc mutant ESCs (m Crygc ESCs)Blastocysts were developed from zygotes harvested from B6D2F1 female mice mated with BALB/cAnSlac-Crygc<m1Sbao> male mice. The zona pellucida was removed with acid Tyrode solution. Each embryo was transferred into 96-well plate seeded with embryonic fibroblast feeders in ESC medium supplemented with 20% knockout serum replacement, 1000 units/ml leukemia inhibitory factor (LIF), 3 µM CHIR99021 and 1 µM PD0325901. 4–5 days after culture, single outgrowth was trypsinized andtransferred to one well of 96-well plates with a fresh feeder and medium. The clonal expansion of ESCs to 6-well plates with feeder cells was performed as routine culture procedure.Cell culture and transfectionE14 and m Crygc ESCs were cultured on gelatin-coated plates with standard ESC culture conditions. ESCs were transfected with a pX330 plasmid including sgRNA targeting Crygc gene using Lipofectamine 2000 (Life Technologies) according to the manufacturer’s instruction manual. 24 h after transfection, the ESCs expressing red fluorescence protein were separated with flow cytometry (Influx™ cell sorter, BD Biosciences) and plated at low density. 5 days after plating, single colony was picked and genotyped with PCR and sequencing.Production of Cas9 mRNA and sgRNAsFirstly, pX330 plasmid including T7 promoter was linearized by Not I. Linearized templates were purified and in vitro transcribed with mMESSAGE mMACHINE T7 ULTRA kit (Life Technologies). sgRNAs with T7 promoter were amplified by PCR and in vitro transcribed using MEGAshortscript T7 kit (Life Technologies). After transcription, the Cas9 mRNA and the sgRNAs were purified with MEGAclear kit (Life Technologies) according to manufacturer’s instructions. The sequences for preparation of template for in vitro transcription of sgRNA were: TAATACGACTCACTATAGGGTACAGAGCCCCAGTCCTGGAGTTTTAGAGC TAGAA (sgRNA-trans-F) and AAAAAAGCACCGACTCGGTG (sgRNA-trans-R). Zygote injectionB6D2F1 (C57BL/6 X DBA2) female mice were superovulated and mated with the male cataract mice (BALB/cAnSlac-Crygc<m1Sbao>). One-cell-stage embryos were collected and injected with Cas9 mRNAs (50 ng/µl) and sgRNA (20 ng/µl). For oligos injection, donor oligo-1 (89bp) or oligo-2 (89bp) (20 ng/µl) was mixed with Cas9 mRNAs (50 ng/µl) and sgRNA (20 ng/µl) and injected into the embryos. The injected embryos were cultured in KSOM until blastocyst stage and transferred into pseudopregnant female mice. The sequences of injected oligonucleotides were:TCTATGAGATGCCTAACTACCGAGGCCGCCAGTATCTGCTGAGGCCTCAA GAGTACCGGCGCTTCCAGGACTGGGGCTCTGTAGATGCT (Oligo-1) and TCTATGAGATGCCTAACTACCGAGGCCGCCAGTATCTGCTGAG A CC A CAA GAGTACCGGCGCTTCCAGGACTGGGGCTCTGTAGATGCT (Oligo-2, two synonymous mutant sites labeled in red.)DNA sequencing analysisThe target site (sequence around Crygc mutation site) was amplified by PCR with specific primers from genomic DNA of the ESC colonies or genetic modified mice. Firstly, the PCR products were sequenced using the primer listed below to confirm whether the sequencing results have single or double peaks. Subsequently, PCR products from each ESC colony or founder were cloned into pMD18T TA cloning vector (Takara) and transformed to competent E. coli. After overnight culture at 37 ºC, 8-16 colonies were randomly picked out and sequenced. The sequences of the primers for the amplification of the targeted sites in Crygc gene were: TCTTACACCAACAGCCTCCTACCTC (Crygc check-1 F), GCACACTGAATAAAAGCTCTATCAC (Crygc check-1 R), CTGCAAGTGCTGGAGGGCTGCTGGG (Crygc check-2 F), ACTGAGGTACATACATATATCTCCA (Crygc check-2 R), ACCAACAGCCTCCTACCTCAGTC (Crygc check-3 F) and AGTCAGGGTTTGCCAACAATACA (Crygc check-3 R).Off-target effect analysisWe searched the genome for sites with a minimum of 14 consecutive nucleotides of identity to the authentic target sequence. We identified a total of 10 potential“off-target” sites. DNA sequencing of PCR products amplified from these genomic sites was performed. The sequences of the primers for the amplification of off-target sites were listed as below.Gm19385, Forward: TGGGAGCCTTTTAGTTCTTGACC; Reverse: TGAATGACCTTTGAGGATTTACC.E17Rik, Forward: CCATCGGACTCAGAAGGAACCTA Reverse: CCTGCACCCATTTCTATCCACTT.Plod1, Forward: AAGGAACCCAATCCAACCTCTGA; Reverse: CCTGCACCCATTTCTATCCACTT.Rnf145, Forward: TGCAGGTTTTCTGTTTGTGCT; Reverse: CCGAGCCTCTGTTGATGTGT.D21RIK, Forward: TTTCCCTCACTAGACATGTGC; Reverse: GGATACTAACTCATAGCAGTTCCC.Prkce, Forward: AGCCAATACTTACACTTGTGGA; Reverse: CAGAGCCAGAGTCTTCGAGT.Dnahc17, Forward: AGAGGCTTAAAACATCTGCT; Reverse: CATAAAATAGCCCCGCTCT.Chd9, Forward: TCTCATGATAGGGATTTGCTC; Reverse: CTCTCGGTTTCTTAGAAGCTG.ZFP592, Forward: TCTCCTACATAATGGATTCCG; Reverse: CCAATACTGTTGCTAGGGTGA.Herc2, Forward: ACGTCCTTCTCACTCACA; Reverse: ATGGATAAAAGAAACTACGGGGA.Histological analysisFor histological analysis, enucleated eyes from 6-week-old mice were fixed in formaldehyde solution. Then the samples were dehydrated and embedded in paraffin. Sections were prepared with an ultramicrotome (RM 2235, Leica). Serial 5-µm sections were cut and collected on glass slides. The sections were stained with hematoxylin and eosin (H&E) after drying and photographed with microscopy (IX 51, Olympus).。