Molecular Characterization and Expression Analysis of NAC Family

ORIGINAL PAPERMolecular Characterization and Expression Analysis of NAC Family Transcription Factors in TomatoXiaohong Kou&Shuang Wang&Mengshi Wu&Runzi Guo&Zhaohui Xue&Nan Meng&Xiaomin Tao&Mimi Chen&Yifei Zhang#Springer Science+Business Media New York2013Abstract The NAC family is considered one of the largest plant-specific transcription factors families,and functions in diverse and vital physiological processes during development. In the present study,we performed a complete bioinformatics analysis of the NAC family transcription factors in tomato,and annotated the non-redundant SlNAC1-74proteins into12sub-groups.Six NAC genes from tomato,which were designated SNAC4–SNAC9,were studied instensively.The expression anal-ysis indicated that each SNAC gene exhibited a specific expres-sion pattern in the tissues examined.SNAC4and SNAC6were most highly expressed in the stems and leaves,whereas the expression levels of SNAC5,SNAC8and SNAC9were higher in young leaves and old leaves,respectively.In addition,the expression patterns of SNAC genes were characterized during the development of tomato fruits.All of the genes were further investigated to determine their responsiveness to hormones,and a coordinated expression was observed.The expression of the SNAC gene transcripts was induced by ABA,SA and short-time ethylene treatment,whereas their transcription was inhibited by GA,6-BA and IAA.Our present study provides a useful refer-ence for future investigations of NAC genes in tomato and other fleshy fruits.Keywords NAC.Transcription factor.Tomato. Development.HormonesIntroductionTranscription factors(TFs)are proteins that interact with DNA promoters and are involved in gene expression and regulation.Various plant TFs,which contain various function-al domains,such as MYB,DREB and NAC,have been well studied.The NAC gene family name is an acronym derived from the first three identified genes containing this domain: NAM from Petunia and,ATAF1/2and CUC2from Arabidopsis(Souer et al.1996;Aida et al.1997).The NAC family members are characterized with a highly conserved NAC domain region at the N-terminal as a functional domain, which can be further divided into five subdomains(A-E).The C-terminal region is highly variable in sequence composition and length and,plays a vital role as a transcriptional activator or repressor(Xie et al.2000;Ooka et al.2003;Tran et al. 2004;Kim et al.2007a).The plant-specific NAC family refers to proteins contain-ing the NAC domain,and is one of the largest transcription factor families in plants.A continuously increasing number of NAC genes have been identified and studied in different plants.There are105and140NAC or NAC-like genes in Arabidopsis and rice,respectively,and these can be further classified into18subfamilies(Ooka et al.2003;Fang et al. 2008).The specific subfamilies are composed of multi-functional proteins involved in various plant biological pro-cesses related to growth and development,including cell division(Kim et al.2006),seed and embryo development (Duval et al.2002;Sperotto2009),the formation of lateral roots and cotyledons(Aida et al.1997;Weir et al.2004;He Xiaohong Kou and Shuang Wang made equal contributions to this work.Electronic supplementary material The online version of this article(doi:10.1007/s11105-013-0655-3)contains supplementary material,which is available to authorized users.X.Kou:S.Wang(*):M.Wu:R.Guo:Z.Xue(*):N.Meng:X.Tao:M.Chen:Y.ZhangSchool of Chemical Engineering and Technology,Tianjin University,Tianjin300072,People’s Republic of Chinae-mail:wangshuang19890720@e-mail:zhhxue@Plant Mol Biol RepDOI10.1007/s11105-013-0655-3et al.2005),the maintenance of shoot apical meristems(Souer et al.1996;Aida et al.1997;Kim et al.2007b;Mao et al. 2007),organ growth and senescence(Sablowski and Meyerowitz1998;Guo and Gan2006;Liu et al.2009;Kou et al.2012a,b),the synthesis of secondary walls(Zhong et al. 2007b;Ko et al.2007)and plant nutrition regulation(Uauy et al.2006;Ogo et al.2008).Transcriptome studies have shown that many NAC tran-scription factors are involved in the response to abiotic stress and hormonal treatments.Furthermore,some of the NAC transcription factors have been reported to be potential genes for the engineering of stress resistance during the plant life-cycle.Interestingly,phylogenetic analysis shows that most of the stress-responsive NACs belong to the ATAF and AtNAC3 subfamilies.The SNAC1and SNAC2genes in rice are in-duced by cold,salinity,drought,and ABA(abscisic acid) treatment,and the transgenic plants that overexpress these genes demonstrate increased tolerance against cold,salt,and drought(Hu et al.2006;Hu et al.2008).SNAC2and OsNAC10can improve the expression of some related genes under stress conditions(Jeong et al.2010).The ANAC19,55 and72genes in Arabidopsis are inducible by drought,salt and ABA,and have been confirmed to be positive regulators in the ABA signaling pathway and stress tolerance(Tran et al. 2004;Fujita et al.2004).NAC genes are also involved in the defense against biotic stress and are up-regulated under con-ditions of pathogen infection and attack.It has been shown that OsNAC19in rice is elevated by Magnaporthe grisea infection(Lin et al.2007).Tomato is one of the most popular fleshy fruits in the world and exhibits a wealth of nutrition.The abundant genetic re-sources available make tomato an essential model system for the study of the development,ripening and senescence of fleshy fruits(Alexander and Grierson2002;Giovannoni2004;Klee and Giovannoni2011).Most available research focuses mainly on model species,such as Arabidopsis and rice,and the char-acterization of NAC genes in tomato is still rudimentary.An NAC gene,SlNAC3,isolated from a tomato flower cDNA library was recently reported(Han et al.2012).A digital anal-ysis revealed that SlNAC3demonstrates a tissue-specific ex-pression pattern and is inhibited by drought,salt stress and ABA treatment.The completion of the high-quality sequencing of the tomato genome has provided an excellent opportunity for the genome-wide analysis of NAC family genes(International Tomato Genome Sequencing Project2012).In the present study,74SlNAC genes were identified and classified according to their phylogeny.The molecular fea-tures of the genes and their encoded proteins were also ana-lyzed.We also studied the developmental expression patterns of six genes,namely SNAC4-9,which belong to the NAP and AtNAC3subgroups in tomato.Through molecular cloning and sequence characterization,we found that all six genes share a similar genomic organization and high sequence similarities,especially within the NAC domains.A tissue-specific expression analysis showed that these genes exhibit different expression patterns,particularly during fruit devel-opment.We further investigated the responses of the genes to hormone treatments.The present study constitutes the first systematic study of NAC genes in tomato,and the information generated suggests that the NAC genes may regulate tomato growth and fruit development.Materials and MethodsPlant Growth and TreatmentsPlants of tomato cultivar AC were used throughout the exper-iments described in this manuscript.The plants were field-grown under normal conditions at Tianjin University.The vegetable tissues,such as leaves,stems and roots,were collected from seedlings starting30days after flowering (DAF),and the open flowers were sampled and prepared for tissue-specific expression assays.The developing fruits from 35to55DAF,at the green mature,breaker,pink,and red ripe stages,were collected,divided into the pericarp,radial peri-carp,and columella,frozen immediately in liquid nitrogen and stored at−80°C until further use.For exogenou hormones treatments,10g tomato fruit tissue discs(diameter of10mm)at the green mature stage were immersed in50ml vials containing0.1mM ABA (abscisic Acid),0.1mM IAA(indole Acetic Acid),0.1mM GA(gibberellic Acid),0.1mM6-BA(6-benzylaminopurine) and1mM SA(salicylic Acid),respectively.The control group discs were treated with the buffer solution(50mmol/L citric acid,100mmol/L sorbitol and0.33mmol/L chlorampheni-col).To evaluate the effects of ethylene treatment,tomato fruits were placed in vials,which were injected with50μL of2%(v/v)ethylene(air as a control)to obtain a final concentration of100μL/L.The hormone treatments lasted 0,2,4,6,8,10,12,24,or48h at23°C.All of the samples were rinsed,frozen in liquid nitrogen and stored at−80°C for further use.Three biological replications were performed for each treatment of sampling time point.Collection of SlNAC Gene Family MembersWe selected10reported NAC protein sequences from five subgroups of the NAC family as queries for a BLASTP search in the tomato SOL database(/),using an e-value of1e-10.The GenBank accession numbers of the repre-sentative genes are the followings:A TAF1/2(X74755/X74766), AtNAM/NAP/AtNAC2(AF123311/AJ222713/AB049071), CUC1/2/3(AB049069/AB002560/AF543194),TIP (AF281062),and AtNAC072(At4g27410).Conserved Domain Database(CDD)search in NCBI(http://www.ncbi.Plant Mol Biol Rep/Structure/cdd/wrpsb.cgi)was performed to confirm the NAC domain of each sequence.Phylogenetic Analysis and Sequence AlignmentPreviously published NAC sequences from Arabidopsis and other species,including Oryza sativa,Brassica napus,Triticum sativa,Antirrhinum majus,were retrieved from the GenBank database.For the phylogenetic analysis,an unrooted tree was constructed with the MEGA5software(Tamura et al.2007) using the Neighbor-Joining method with1000bootstrap replicates.A multiple sequence alignment of the representative pro-tein sequences of SNAC4-9was performed using the ClustalX1.83program(Thompson et al.1997).The GenBank accession numbers of the reported proteins were the following:CitNAC(EF185419)/AtNAM(AF123311)/ NAP(AJ222713)/AtNAC2(AB049071)/GmNAC1 (AY974349)for NAP and,AtNAC3(AB049070)/ AtNAC019(At1g52890)/AtNAC072(At4g27410)/ GmNAC3(AY974351)/GmNAC4(AY974352)for AtNAC3.Sequence AnalysisInformation regarding the SlNAC gene structures,chromosomal localizations,and transcripts was procured from the SOL data-base.The positions of the SlNAC genes on the tomato chromo-some maps were drawn and modified manually,with annotation. The protein-encoding characteristics were procured from ExPASy ProtParam(/protparam/),and the hydrophobic maps were further verified by ProtScale(http://web. /protscale).A protein motif analysis was accomplished using the SMART database(http://smart.embl-heidelberg.de/),and the transmembrane proteins were further confirmed by TMHMM(http://www.cbs.dtu.dk/services/ TMHMM-2.0/).The subcellular localizations were predicted by WoLF PSORT(/).A transcriptome analysis of various tissues in the tomato cultivar Heinz and the wild relative Solanum pimpinellifolium was used to predict the SlNAC gene expression patterns.The data corresponding to the SlNAC genes were downloaded from the Tomato Expression database(/).Based on the data,the heat map was generated using the MeV4.8software(http://www.tm4. org/mev.html)following the instruction of the software.By expressing the signal strength and expression directly reflects the gap,screening candidate genes.The digital expression analysis of tomato SlNAC genes was performed by the visual reflection of signal strength and expression disparity.RNA Extraction and RT-qPCR AnalysisIsolating RNA from samples ready for the reverse transcriptase quantitative PCR(RT-qPCR)applications was performed using the Column Plant RNAOUT kit(Tiandz#71203,China).The concentration and quality of the RNA samples were examined using spectrophotometer(Nanodrop ND-1000).Samples cDNA was synthesized using the Transcript One-Step gDNA removal and cDNA synthesis supermix(TransGen#AH11-03,China). qPCR analyses of individual genes were designed using Primer5.Briefly,for each qPCR reaction,1μL each diluted sample was used as a template in a25μL reaction containing 12.5μL2×SYBR green supermix(TransGen#AQ101),8.5μL ddH2O and0.5μL of each primer.All qPCR reactions were performed on Light Cycler480thermocycler with45cycles. Cycle threshold(C t)values were determined by the Light Cycler software assuming100%primer efficiency.Theβ-tublin gene was used as an internal control.The Primer pairs used in this research are shown in Table1.For the development analyses,the expression levels of individual genes in the root(R)or pericarp at green stage(G1)were set to1.For the hormone treatment analyses,the expression levels of individual genes under0h treatment were set to1.Statistical MethodsThe RT-qPCR gene expression was quantified using the2-△△Ct comparative methods.Results are presented as the means±standard deviation from three biological replicates of each experiment.The significant differences(p=0.05)between mean values were determined by analysis of variance (ANOV A)using IBM SPSS Statistics20(SPSS commercial software,SPSS Inc.,Chicago,IL,USA)software.ResultsIdentification of SlNAC GenesAfter the sequencing of the tomato genome was completed, we used10reported NACs as sequence entries for an exhaus-tive search.By removing any redundant sequences and dif-ferent transcripts of the same gene,we identified74putative SlNAC genes preliminarily.The protein-encoding sequences were confirmed by CDD for the presence of the NAM do-main.For convenience,we designated the genes SlNAC1to SlNAC74according to the chromosome distribution.Phylogenetic Analysis and Sequence AlignmentThe clarification of the phylogenetic relationships and classi-fications is important for the functional prediction of this gene family.A combined phylogenetic tree was constructed with the aligned SlNAC and published NAC sequences using the MEGA5software(Fig.1).Of the74total SlNACs,54SlNACs were divided into12 subgroups with high bootstrap support.The subgroups werePlant Mol Biol Repnamed by the homologous NACs,according to Ooka’s classifi-cation(Ooka et al.2003).Eleven,nine,seven,and five SlNACs belonged to the NAM,VND,TERN,and ANAC063subgroups, respectively,whereas the NAC2and TIP subgroups contained four SlNACs each,the NAP,A TAF and ANAC011subgroups contained three SlNACs each,the AtNAC3and SENU5sub-groups contained two SlNACs each,and the NAC1subgroup contained one SlNAC.The remaining20sequences had less homology with the known NACs and were clustered into differ-ent unknown subgroups.SlNAC20was clustered as a member of the A TAF subgroup and was most closely related to StNAC. SlNAC46belonged to the NAM subgroup,and SlNAC49was clustered into the NAC1subgroup.SlNAC69was a member of the TERN subgroup.The identities of SlNAC70and NTL,were high,i.e.,approximately99%.Our data showed that SlNAC1 was homologous to SENU5with high bootstraps support. SlNAC48and SlNAC59were highly related,shared99%se-quence similarity and were classified as members of the NAP subgroup.The deduced proteins SlNAC47and SlNAC71were classified as members of the AtNAC3subgroup.For further research,we selected six genes belonged to the NAP and AtNAC3subgroups,and conveniently renamed SlNAC48,71, 59,24,47and19as SNAC4,5,6,7,8and9,respectively,based on a previous report regarding SlNAC3(Han et al.2012).The amino acid alignments of SNAC4,5,6,7,8and9and other members of the NAP and AtNAC3subgroups are shown in Fig.2.Higher sequence similarities were found in the N-terminus regions.The N-terminnus was composed of approxi-mately150amino acids and contained a conserved NAM do-main,which had five distinguishable subdomains(A–E).The C-terminal regions were divergent in amino acid composition,and contained a number of simple amino acids,such as Ser,Thr,Pro and Glu.Features of SlNAC GenesTo examine the specific properties of SlNAC genes,we identified their genomic distributions and the structural features of each gene using the SOL database(Supplementary Table1).In total, 74genes were localized on12chromosomes with an uneven distribution(Fig.3).The genes were present in different regions of the chromosomes,including at the telomeric ends,around the centromere,and in between the telomere and the centromere. Chromosome6had the largest number(13)of SlNAC genes, followed by eight genes on chromosomes7and11.In contrast, only two genes were found on chromosome9.Most of the SlNAC genes on chromosomes2,3,6and7were found on the long arms of the chromosomes,whereas the SlNAC genes on chromosomes4,5,8and7were located at both ends.The SlNAC genes could be classified into three types according to their number indexes of exons/introns.The first type contained48genes with the number index3/2.The second type had six genes that had one or no intron,such as SlNAC12,33and45in the AtNAC063subgroup.The third type could be further divided into smaller subtypes with the number indexes4/3,5/4and6/5.The highest numbers of the exons and introns were found in SlNAC8,which contained17 exons and16introns.Features of SlNAC ProteinsTo analyze the subcellular localizations,conserved domains and motifs of SlNAC proteins,we used website-accessible software as described in materials and methods.As shown in Supplementary Table1,most of the proteins were acidic,with PI values ranging from4.58to7.0,and the highest observed PI value was9.47.The instability indexes ranged from24.28 to61.3,and most SlNAC proteins had an index higher than 40.According to the amino acid indexes,the proteins were rich in Ser,Lys,and Asn.The subcellular localization predictions suggested that ap-proximately half of the SlNACs were localized in the nucleus, whereas five,four,and three were localized in the peroxisome, cytosol,and chloroplast,respectively.In addition,subcellular localization predictions suggested the cytoskeletal localization of SlNAC5,the mitochondrial localization of SlNAC29,and that SlNAC11and37could be located in either the nucleus or the cytosol.SlNAC proteins were divergent in their motif compositions. The SlNAC members all had one NAM domain as the charac-teristic conserved domain.Forty-four SlNAC proteins contained one or more low complexity region in the downstream region ofTable1Primer pairs used in thisresearch Gene Forward-Primer(5′-3′)Reverse-Primer(5′-3′)Tm(°C)SNAC4TGCCTCTGTTCCTCTTCCTG TCTTGTTCTCCAAATGTCGC53SNAC5ATTCTCGCTGGGCTCAAAC GGAGGATGGGCGTAAACAT53SNAC6TGTTGAGAACAACGAGGACG AGGAAATTGGCAA TGGAGC53SNAC7CTCTGATCTTCCTCCTGGATTT CAGGGATCGAACTTGTAGACAT53SNAC8CTGGGAACTTCGA TTGGGCT GTTTGA TTTCCCGGCGTTGG53SNAC9CCCTCCTGGATTTAGGTTTC CCAGGGATCGAACTTATAGACA53β-tublin CACGTGGGTCCAGCAATAC GGTCAGCAGCACACA TCA TGT60Plant Mol Biol Repthe sequence.Some proteins in the TIP and NAC2subgroups had coiled coil regions.SlNAC21,27,64and 65in the A TAF and NAC2subgroups included a transmembrane region.In addition,SlNAC68had two internal repeat regions in sequence,and SlNAC37had a VQ conserved domain.Digital Expression Patterns of SlNAC GenesTo forecast the expression profiles of the SlNAC genes during the tomato development process,we acquired the digital ex-pression normalized (RPKM)data from a transcriptome anal-ysis of various tissues in the tomato cultivar Heinz and the wild relative Solanum pimpinellifolium from the TED data-base.As shown in Fig.4,some members of the NAP,ATAF,AtNAC3,NAC2,TIP and TERN families,such as SlNAC14,20,24,28and 61were constitutively expressed in all of the tested organs.However,members of the VND,NAM and TERN subgroups were weakly expressed.SlNAC9,30,34,35,52and 72,which belong to subgroup VND,were strongly expressed in the roots,and SlNAC18and 41were strongly expressed in the flower buds and petals.Notably,there were two opposite expression patterns observed during fruit devel-opment.The first,which was observed for SlNAC3,exhibited an increase in expression during maturation.And the second,which was found for SlNAC20,exhibited a decrease in ex-pression in the transition from the immature to mature stages.Tissue-Specific Expression of SNAC GenesAlthough the phylogenetic analysis provided important bio-informatics support for candidate genes selection,expression analysis is better for the further investigation of SNAC tran-scription factors.To elucidate the expression patterns of SNAC genes,RT-qPCR analysis was performed (Fig.5).The β-tubulin gene,which was used as an internal control for constitutive expression,was uniformly expressed in allofFig.1Evolutionary relationship of SlNAC and some homologous pro-teins in other plants.The multiple alignment was made using ClustalX and N-J tree was constructed with a 1000-bootstrap replication support.The subfamilies within the NAC family were grouped as indicated.Accession numbers of the reported NACs are as follows:ATAF1(X74755);ATAF2(X74755);AtNAM (AF123311);NAP (AJ222713);AtNAC2(AB049071);TIP (AF281062);CUC1(AB049069);CUC2(AB002560);CUC3(AF543194);AtNAC072(At4g27410);AtNAC3(AB049070);NAC2(AF201456);ANAC055(At3g15500);ANAC019(At1g52890);ANAC011(EFH67253);BnNAC1-1(AY245879);BnNAC3(AY245880);OsNAC1(AB028180);OsNAC2(AB028181);OsNAC3(AB028182);OsNAC4(AB028183);OsNAC5(AB028184);OsNAC6(AB028185);OsNAC7(AB028186);OsNAC8(AB028187);GRAB1(AB028187);GRAB2(AJ010830);NAM (X92205);ZmNAC1(ABY67929);SENU5(Z75524);StNAC (AJ401151);GmNAC1(AY974349);GmNAC2(AY974350);GmNAC3(AY974351);GmNAC4(AY974352);GmNAC5(AY974353);GmNAC6(AY974354);CitNAC (EF185419);TERN (AB021178);CarNAC5(ACS94038);ANAC063(AEE79353);VND1(AEC06722);SND1(ABL67723);NTL8(EFH57163)Plant Mol Biol RepEDC BAFig.2Amino acid sequences comparisons between SNAC4-9and members of NAP and AtNAC3subgroup.Identical amino acids are shaded in the same colour.Subdomains in the N-terminal regions were indicated by A-EPlant Mol Biol Repthe tissues examined.Each SNAC gene showed a unique expression pattern.SNAC4mRNA was accumulated in all of the tissues at a similar expression level.SNAC5was expressed strongly in the leaves but weakly expressed in the roots and flowers.Moreover,the expression level of SNAC5in young leaves was obviously higher than that obtained in old leaves.The analysis of SNAC6revealed a higher level of expression in the stems and leaves and,a relatively lower expression level in the roots.SNAC7was predominantly expressed in the stems.The expression of SNAC8was mostly observed in old leaves and flowers,but expression was also observed at very low levels in the roots and young leaves,which is different from the expression pattern of SNAC5,although the two genes had a high sequence similarity.The expression pattern was consistent with the development.SNAC9was constitutively expressed in all of the tissues,although a relatively higher level of expression was observed in old leaves.The expression patterns of SNAC genes during fruit devel-opment were also studied (Fig.6).For the expression analysis,the β-tubulin gene was used as an internal control.In tomato fruits,the expression level of SNAC4increased with the maturation process and reached its highest expression levels at the red ripe stage,which is consisten with the maturation process.The SNAC4expression level was high in the colu-mella at the green mature and breaker stages,but was signif-icantly higher in the pericarp compared with the columella and the radial pericarp late in the maturation process.The analysis of the expression of SNAC5revealed that it is the expressed at higher levels at the pink stage in different parts of the fruits,with no obvious difference.Throughout development,the expression of SNAC5first decreased in the pericarp and then increased,and the lowest level was observed at the breaker stage.The SNAC5expression in the columella presented a clear upward trend,and the highest levels were observed at thered ripe stage.However,the obvious expression differences between the columella and other regions during the same period still require further investigation.On the whole,the highest expression levels of SNAC6were observed during the pink period,followed by the breaker stage.At the red ripe stage,the tomato fruits progress from late-maturation to the senescence process,and the expression signals for SNAC6slowly weakened.SNAC6expression in the pericarp and radial pericarp was weak in the early stage and gradually increased with the development process.There was a promi-nent increase in the expression of SNAC7in different regions throughout the during the entire development process.The SNAC7expression in the pericarp reached a maximum level at the red ripe stage,whereas its expression in the radial pericarp and columella was low at the pink pared with the other genes,SNAC8was expressed in the earliest developmental stage.Fruits at the breaker stage and the red ripe stage exhibited a higher SNAC8expression level.The expression profile of SNAC9was similar to that of SNAC7,and the levels in the pericarp were higher than those obtained in other regions at similar stages.Expression Profiles with Hormone TreatmentsPlant hormones play an important role in the regulation of the development and maturation of fruits.To detect the impact of hormones on the expression of the target genes (SNAC4-9),green mature fruit discs were treated with ABA,IAA,GA,6-BA,SA,and ethylene.Compared with the control group,SNAC4was observed to be down-regulated following ABA treatment (Fig.7-a).SNAC5were up-regulation during short-term treatment with ABA for 2–6h.ABA treatment promoted SNAC6,SNAC7and SNAC9genes expression during the 6–8h,and the up-regulation of this gene increased with extendedtreatmentFig.3Distributions of SlNAC genes on the 12chromosomes in tomato.Chromosome numbers were indicated at the top of each bar.The scale on the left was in megabases (Mb)Plant Mol Biol RepFig.4Heat map representation of tissue-specific expression of74 SlNAC genes.Color bar at top shows level of expression.Red indicated expressed genes and green indicated unexpressed ones.R=root;L=leaf; FB,F=flower buds and opened flowers;Fr(1)/(2)/(3)=1/2/3cm fruit, respectively;MG=mature green fruit;Br and Br+10=fruits at breaker and breaker+10days stage.The above were samples of tomato cultivar Heinz.l=leaf;img=immature green fruit;brand br+5=fruit at breaker and breaker+5days stage.The last four ones were samples of Solanum pimpinellifoliumPlant Mol Biol Reptimes.SNAC8displayed a significant induction within 2h,but the transcript accumulation declined to normal levels after 4h of ABA treatment.On the whole,SA treatment had a better effect on the upregulation of SNAC4-9than ABA treatment,and the influence of the treatment time was obvious for some genes (Fig.7-b).SA treatment efficiently induced SNAC5and SNAC6expression within 2h of treatment but did not induce expression after 2h.The expression levels of the genes SNAC7was downregulated,but expression of SNAC9was increased under SA treatment remarkably.All of the genes,except SNAC9,were down-regulated by GA treatment,and the inhibition of expression was obvious under short-term treatment (Fig.7-c).The expression level of SNAC8,at 4h was 1.5-fold higher than that at 2h.In contrast,an influence of the treatment time on the other genes was not observed.The upregulation of SNAC9by GA was detected,which indicates that this gene is likely to be involved in the GA response pathways.The expression signals were weak in the IAA treatment group and exhibited obvious differences,com-pared with the control group.These results suggest that IAA treatment can inhibit SNAC4-9gene expression (Fig.7-d).Longer treatment times slightly weakened the inhibition,ob-served with the GA treatment,but evident differences were observed between different IAA treatment times.The expression level of SNAC8after 8h of IAA treatment was nearly three-fold higher than that obtained after 2h of treatment,and the former showed little difference with the control group,which suggests that the inhibition was weaker after longer treatment times.The down-regulation of expression was detected after 6-BA treat-ment,which indicates that these genes are likely involved in the 6-BA response pathways (Fig.7-e).The transcript accumulation obtained in the 6-BA treatment groups was similar to that obtained in the control,with some obvious variations.Taken together,these results indicated that SNAC6-9genes were in-volved in the general response to plant hormones.ABA and SA treatment positively regulated SNAC genes expression,whereas GA,IAA and 6-BA down-regulated the accumulation of these transcripts.In addition,the treatment time appears to have an effect on the induction of the expression of these genes.Because the effects of gas treatment may not be obvious,RT-qPCR analysis was performed to examine the induction of SNAC genes in response to ethylene treatment (Fig.8).Ethylene treatment efficiently induced SNAC genes expression within one day,however,the transcript accumulation declined to normal levels or even lower levels than those obtained in the control group after 24h of treatment.Within 6h of ethylene treatment,SNAC4and SNAC6were down-regulated,but their expression levels exhibited no obvious differences compared with those obtained for the control after 6h of treatment.R e l a t i v e e x p r e s s i o nR e l a t i v e e x p r e s s i o nFig.5SNAC genes expression in different tissues.R:Root;S:Stem;YL:yong leaves;OL:old leaves;F:flowers.Relative expression levels were calculated and normalized with the respect to the expression of the targeted gene in roots.Significant (P =0.05)differences between means are indicated by different letters.The expression levels of individual genes in the root (R)were set to 1SNAC4SNAC5SNAC6R e l a t i v e e x p r e s s i o nSNAC7SNAC8SNAC9R e l a t i v e e x p r e s s i o nFig.6SNAC genes expression in tomato fruits during development and senescence.G:Green mature;B:breaker;P:Pink;R:Red ripe.1:pericarp;2:radial pericarp;3:columella.Relative expression levels were calculated and normalized with the respect to the expression of the targeted gene in green mature fruits pericarp.Significant (P =0.05)dif-ferences between means are indicated by different letters.The expression levels of individual genes in the pericarp at green stage (G1)were set to 1Plant Mol Biol Rep。