链带藻分离响应面优化

Isolation of a novel microalgae strain Desmodesmus sp.and optimization of environmental factors for its biomassproductionFang Ji a ,e ,Rui Hao b ,Ying Liu c ,e ,Gang Li d ,e ,Yuguang Zhou a ,e ,⇑,Renjie Dong a ,eaCollege of Engineering/Biomass Engineering Center,China Agricultural University,PR China bCollege of Food Science ca r t i c l e i n f o Article history:Received 11June 2013Received in revised form 17August 2013Accepted 19August 2013Available online 26August 2013Keywords:Desmodesmus sp.Biomass production Environmental factorsResponse surface methodologya b s t r a c tA novel strain of unicellular green algae was isolated from fresh water samples collected from Yesanpo National Geopark,Laishui County of Hebei Province,China.The morphological and genomic identification of this strain was carried out using 18s rRNA analysis.This novel strain was identified as Desmodesmus d as EJ15-2.Environmental factors for biomass production of Desmodesmus sp.EJ15-2grown under autotrophic condition (BG11medium)was optimized using response surface methodology (RSM).A high correlation coefficient (R 2=0.923,p 60.01)indicated the adaptability of the second-order equation matched well with the growth condition of this strain.The optimalconditions for a relatively high biomass production (up to 0.758g/L)were at 30°C,98l mol/m 2/s and 14:10(L:D),respectively.Ó2013Elsevier Ltd.All rights reserved.1.IntroductionMicroalgae,asan important source of the third generation bio-fuel,can be reproduced rapidly,and can minimize or avoid the occupation of arable land and nutrients used for conventional agriculture (Scott et al.,2010;Bhatnagar et al.,2011).Energy from0960-8524/$-see front matter Ó2013Elsevier Ltd.All rights reserved./10.1016/j.biortech.2013.08.110⇑Corresponding author.Address:P.O.Box 50,No.17Qinghua Donglu,HaidianDistrict,Beijing 100083,PR China.Tel.:+861062737858;fax:+861062737885.E-mail addresses:zhouyg@ ,zhouyuguang@ (Y.Zhou).microalgae could be a viable substitute for fossil fuels in the future (Wijffels and Barbosa,2010).Unicellular eukaryotic microalgae are the products of over3billion years of evolution,and are highly di-verse(Falkowski et al.,2004).In recent years,a large number of useful microalgae have been isolated(Mishra and Jha,2009; Schwenzfeier et al.,2011;Yoshida et al.,2006).Microalgae produc-tion for fuel purposes varies on its strain and cultivation conditions (Chen et al.,2010).However,it is not economically feasible since it has much high-er production costs(Behzadi and Farid,2007).This requires high biomass production and utilization ratio to reduce its unit produc-tion cost(U.S.DOE,2010).A large quantity of water consumption, which is considered to be one of the most important issues,occu-pies10–20%of the total costs of algae production(Subhadra,2011; Chinnasamy et al.,2010).Harvesting costs contribute20–30%to the total costs with the majority on cultivation expenses(Demirbas and Demirbas,2011).It is necessary to isolate new microalgae spe-cies which have much higher biomass productivity and stronger adaption to the environment than common species so that the unit production cost could be reduced.Environmental factors have significant effect on microalgae bio-mass production and the changing conditions cause various influ-ences on the biomass production of different species of microalgae (Li et al.,2011).Light radiation,temperature and pH value will most directly affect productivity(Soletto et al.,2008;Mata et al., 2010;Xenopoulos et al.,2002).The light intensity and photoperiod are the critical components in determining the biomass production of algae cultivation(Parmar et al.,2011).Maximal photosynthetic efficiency is required to attain high biomass production.The light obviously avails the microalgae growth although long high-light periods cause the photodamage which will decrease the photosyn-thetic efficiency(Grima et al.,1996).In addition,the light/dark cy-cle strongly depends on the light intensity in the photoperiod. (Barbosa,2003).The major objective of this work is to isolate a new species of microalgae andfigure out its optimal growth conditions,concern-ing on temperature,pH value,light intensity and photoperiod.The mutual effect of different environmental factors on biomass pro-duction by current species of microalgae grown under autotrophic condition was also investigated.2.Methods2.1.Isolation,identification and cultivationDesmodesmus sp.EJ15-2was isolated in September2011from freshwater samples,which was collected from Yesanpo National Geopark(39°2303500N,115°4202700E),Laishui County of Hebei Province,China.Desmodesmus sp.EJ15-2was purified by serial dilutions and plate streaking in1.5%agar Blue-Green(BG-11)med-ium(Rippka et al.,1979),which was consisted of1500mg/L NaNO3,40mg/L K2HPO4,75mg/L MgSO4Á7H2O,36mg/L CaCl2Á2H2-O,6mg/L citric acid,6mg/L ferric ammonium citrate,1mg/L EDTANa2,20mg/L Na2CO3,and1mL/L A5trace metal solution. The recipe of A5trace metal solution was:2.86g/L H3BO3,1.86g/ L MnCl2Á4H2O,0.22g/L ZnSO4Á7H2O,0.39g/L Na2MoO4Á2H2O, 0.08g/L CuSO4Á5H2O,and0.05g/L Co(NO3)2Á6H2O.The pH value of the medium was titrated to7.0with1mol/L HCl.Individual col-onies were inoculated into liquid BG-11media within a forced ven-tilation clean bench(Suzhou Antai Airtech SW-CJ-2FD).All media was autoclaved for sterilization at121°C and lasted for20min.The seed cultures were grown in100mLflasks containing 50mL of BG-11medium and incubated at25±1°C with illumina-tion,which was provided byfluorescent lights at an irradiance of 80±2l mol/m2/s(the light/dark periods was14:10)for14d.Peri-odic agitations were performed each day at9:00,15:00,and20:00, respectively.2.2.DNA analysisThe genomic DNA of Desmodesmus sp.EJ15-2was extracted using the NuClean PlantGen DNA kit(Beijing ComWin Biotech Co.,Ltd.,China)according to the manufacturer’s instructions.18S rDNA genes were Polymeric Chain Reaction(PCR)ampli-fied using the forward(50TACTGTGAAACTGCGAATGGCTC30)and reverse(50TGATCCTTCCGCAGGTTCACCTA30)primers(primers synthesized by the Sangon Biotech(Shanghai)Co.,Ltd.,China). ITS1genes were amplified using the forward(50AGTCGTAAC AAGGTTTCCGTAGG30)and reverse(50TATGCTTAAGTTCAGCGG GTAAT30)primers.All of those primers were designed by DNAMAN (USA)and Primer5.0(Canada).PCR products were sequenced by the Life Technologies Corpora-tion(China).Comparisons for similar sequences were carried out using the BLAST Program(NCBI BLAST,USA).2.3.Biomass productionApproximately50mL of the culture medium with Desmodesmus sp.EJ15-2wasfiltered through a0.45l m glassfiberfilter(What-man,USA).The harvested cells were air dried at80°C for24h. Dried samples were allowed to cool down in a dessicator and weighed(Chae et al.,2006).Generally,dry cell weight(DCW)of microalgae is correlated to the optical density(OD)at the certain wavelength from450nm to 680nm,which means to monitor the abundance of cells containing pigment conveniently(Shen et al.,2008;MacIntyre and Cullen, 2005).In this study,the OD of Desmodesmus sp.EJ15-2was deter-mined by measuring optical density of680nm(OD680)via an ultra-violet photospectrometer.The results were converted to DCW by calculation and the coefficient of OD680to algae optical density was introduced(Moon,1983).2.4.Biomass production in different temperature,light intensity,light/ dark cycle and pH valueIn order tofigure out the environmental limits to the biomass productivity of Desmodesmus sp.EJ15-2under autotrophic condi-tion,the temperatures used in this study were15,20,25and 30°C;the light intensities were40,80,120and200l mol/m2/s, which were controlled by varying the number offluorescent lamps as well as the distance between the lamps and algae culture;the photoperiodics investigated were24:0,18:6,14:10and6:18h (L:D);and the pH values were gradually adjusted to5.0,6.0,7.0, 8.0,9.0,and10.0with HCl or NaOH.The other conditions were the same as Part2.1.2.5.Experimental design and data analysisIn order to optimize the environmental factors for the growth of Desmodesmus sp.EJ15-2,central composite design(CCD)andTable1Levels of factors chosen for the experimental design.Level Temperature(°C)(X1)Light intensity(l mol/m2/s)(X2)Light/dark cycle(L:D)(X3)pH(X4) +23020024:010+12616019:5902212014:108À118809:157À214404:206250 F.Ji et al./Bioresource Technology148(2013)249–254response surface methodology(RSM)were employed for random experimental design(Deepak et al.,2008).The total number of experiments for four variables was30(2k+2k+n0),where k is the number of independent variables and n0is the number of rep-etitions of the experiments at the center point(Can et al.,2006). Totally24experiments were augmented with6replications at the center values to evaluate the pure error.For statistical calcula-tions,the relation between the coded values and actual values are described as Eq.(1):x i¼X iÀX0D X ið1ÞWhere x i is the dimensionless value of an independent variable;X i is the real value of an independent variable;X0is the value of X i at the center point;and D X i is the step change.The response was measured in terms of biomass productivity (Y).The behaviour of the system was determined by assuming a second order polynomial with linear,quadratic and interaction ef-fects as shown by Eq.(2)(Khattar and Shailza,,2009):Y¼b0þX ni¼1b i X iþX ni<jb ij X i X jþX nj¼1b jj X2j:ð2ÞWhere Y is response;X1,X2,X3and X4are input variables;b0is con-stant;b i is linear coefficient;b ij is interaction coefficient;and b jj is quadratic coefficient.Based on the obtained results(see Part2.4),the ranges of four factors,temperature(X1),light intensity(X2),light/dark cycle(X3) and pH(X4)were decided with different levels(Table1).Coded lev-els,and the experimental values and predicted values of biomass productivity(Y)were shown in Table2.Estimation of regression coefficients and statistical tests were implemented in the MINITAB Version15(Minitab Inc.,State Col-lege,PA,USA)statistical software based on the RSM.Analysis of variance(ANOVA)was conducted on the coded level of variables to identify the effects of individual variables.Stepwise deletion ap-proaches of individual non-significant(p<0.05)terms were con-ducted to simplify the regression equation by recalculation of the coefficients.At least three replicates were conducted.3.Results and discussion3.1.Isolation and identification of microalgaeThe microalgae EJ15-2was screened among21strains that iso-lated from different water samples.There were a lot of single,dou-ble or quadratic cells surrounded in green cells under thefield of optical microscope.The cells were ellipse with smooth surface, 4–6l m in length,and3–4l m in width.The18S rRNA gene se-quence that amplified from strain EJ15-2was1635bp while the ITS1was592bp.Both of them were with no heterogeneity.The phylogenetic analysis indicated that this strain have a close rela-tionship with Desmodesmus sp.(Fig.1).3.2.Biomass productionThere was a direct correlation between optical density and DCW,which can be described as Eq.(3):Y¼0:3446XÀ0:0048ð3ÞWhere Y is the DCW(g/L);X is the optical density at680nm.They have significant correlation coefficient(R2=0.993).3.3.Effect of different experimental factors on Desmodesmus sp.EJ15-2biomass productionAs shown in Fig.2a,the growth profiles of Desmodesmus sp. EJ15-2were very similar in20,25and30°C,with0.577,0.569 and0.531g/L at the end of14d cultivation,respectively.However,Table2Random experimental design and results based on RSM for biomass productivity.Experiment no.Coded level Biomass productivity(Y)X1X2X3X4Experimental value(g/L)Predicted value(g/L)111110.485±0.0150.5342111À10.602±0.0110.534311À110.583±0.0190.534411À1À10.522±0.0120.53451À1110.638±0.0130.61161À11À10.634±0.0080.61171À1À110.634±0.0140.61181À1À1À10.613±0.0140.6119À11110.376±0.0130.39610À111À10.384±0.0160.39611À11À110.477±0.0090.39612À11À1À10.397±0.0060.39613À1À1110.426±0.0160.47314À1À11À10.447±0.0100.47315À1À1À110.508±0.0080.47316À1À1À1À10.443±0.0100.4731720000.605±0.0160.74718À20000.403±0.0090.4711902000.339±0.0100.394200À2000.542±0.0100.5482100200.312±0.0270.3232200À200.272±0.0120.3232300020.483±0.0090.60924000À20.660±0.0120.6092500000.618±0.0260.6092600000.622±0.0180.6092700000.616±0.0030.6092800000.618±0.0120.6092900000.618±0.0180.6093000000.610±0.0200.609F.Ji et al./Bioresource Technology148(2013)249–254251the biomass production was significantly reduced at15°C.It was reported that the optimum growth temperature was20–25°C for most algae(Butterwick et al.,2005).The comparison of the cell growth indicated that Desmodesmus sp.EJ15-2was not sensitive to different pH values(5–10),with the DCW obtained in a small period were0.453–0.569g/L(Fig.2b).As shown in Fig.2c,the effect of light intensity on the growth of Desmodesmus sp.EJ15-2was significant.The biomass production reached the maximum value(0.569g/L)under80l mol/m2/s after 14d cultivation;and it was far greater than under40and 200l mol/m2/s.An study mentioned that at56.6l mol/m2/s,the photosynthetic rate of wild strains of Chlamydomonas reinhardtii increased with the enhance of light intensity until a certain limit (301.9l mol/m2/s)when the photosynthetic rate began to go down (Murphy and Berberoglu,2011).The results indicated that photo inhibition took place in Desmodesmus sp.EJ15-2under strong light.Fig.1.Dendrogram depiting the partial results of a neighbor-joining analysis of ITS1sequences(MEGA5.10).parison of Desmodesmus sp.EJ15-2dry cell weight under different environmental factors:(a)temperature,(b)pH,(c)light intensity and(d)light/darkFig.3.Response surfaces of the environmental factors effects on biomass accumu-lation by Desmodesmus sp.EJ15-2.The interaction between:(a)temperature and light intensity,(b)temperature and light/dark cycle and(c)light intensity and light/dark cycle.Y¼0:609À0:03440:025x2À3ðÞ2À0:07150:2x3À2:8ðÞ2þ0:0690:25x1À5:5ðÞÀ0:03850:025x2À3ðÞð4ÞWhere Y is DCW(g/L);X1is temperature(14<X1<30°C);X2is light intensity(40<X2<200l mol/m2/s);and X3is light/dark cycle (4<X3<24h).Thus,based on Eq.(4),the optimal condition for biomass pro-duction was at30°C,98l mol/m2/s,and14:10(L:D);and the max-imum DCW was0.758g/L under this condition after14d cultivation.The accuracy of the model was validated with at least three replicates giving the biomass production of0.741±0.005g/L, which concurred with the model prediction.The response surfaces of environmental factors for maximum biomass production of Desmodesmus sp.EJ15-2have been estab-lished(Fig.3a and c)according to the model.As presented in Fig.3a and Fig.3b,an increase in biomass pro-duction was observed with the enhancement of the temperature within the experimental range.Fig.3a showed that the effects of temperature and light intensity on the DCW when the other vari-ables were held at constant level.It was observed that the biomass production significantly increased with increasing temperature at a given light intensity.Fig.3b revealed a uniform trend towards similarly increase in temperature,and its photoperiod was14:10 (L:D).It can explain that Desmodesmus sp.demonstrates excellent thermo-tolerant performance(Pan et al.,2011),more biomass pro-duction under higher temperature compared with other microal-gae species.Fig.3c showed the response contours of biomass production of Desmodesmus sp.EJ15-2against light intensity with light/dark cy-cle after14d cultivation.The values and signs on regression coef-ficients suggested that the response was positive for light intensity up to98l mol/m2/s and light/dark cycle remain stable at14:10h (L:D).The experimental and the predicted values were very close and did not reflect the accuracy and the applicability of RSM.4.ConclusionsA novel green microalgae strain,Desmodesmus sp.EJ15-2,was isolated and identified from fresh water.Results from this study have demonstrated a process that using RSM to optimize the environmental factors.The optimal conditions for a relatively high biomass production(up to0.758g/L)were at30°C,98l mol/m2/s and14:10(L:D),respectively.AcknowledgementsThis investigation wasfinancially funded by The Chinese Na-tional Advanced Technology Development Program(Grant No. 2013AA065802),The Chinese National‘‘Twelfth Five-Year’’Plan for Science&Technology Supporting Project(Grant No. 2012BAD47B03),The Chinese Universities Scientific Fund(Grant No.2013YJ007),The Second Class General Financial Grant from the China Postdoctoral Science Foundation(Grant No. 2011M500451),and Beijing Municipal Key Discipline of Biomass Engineering.ReferenceBarbosa,M.,2003.Microalgal Photobioreactors:Scale-Up and Optimization.Wageningen University,Netherlands.Behzadi,S.,Farid,M.M.,2007.Review:examining the use of different feedstock for the production of -Pac.J.Chem.Eng.2,480–486.Bhatnagar, A.,Chinnasamy,S.,Singh,M.,Das,K.C.,2011.Renewable biomass production by mixotrophic algae in the presence of various carbon sources and wastewaters.Appl.Energ.88,3425–3431.Butterwick, C.,Heaney,S.I.,Talling,J.F.,2005.Diversity in the influence of temperature on the growth rates of freshwater algae,and its ecological relevance.Freshwater Biol.50(2),291–300.Can,M.Y.,Kaya,Y.,Algur,O.F.,2006.Response surface optimization of the removal of nickel from aqueous solution by cone biomass of Pinus sylvestris.Bioresour.Technol.97(14),1761–1765.Chae,S.R.,Hwang,E.J.,Shin,H.S.,2006.Single cell protein production of Euglena gracilis and carbon dioxidefixation in an innovative photo-bioreactor.Bioresour.Technol.97,322–329.Chen,C.,Yeh,K.,Su,H.,Lo,Y.,Chen,W.,Chang,J.,2010.Strategies to enhance cell growth and achieve high level oil production of a Chlorella vulgaris isolate.Biotechnol.Progr.26,679–686.Chinnasamy,S.,Bhatnagar,A.,Hunt,R.W.,Das,K.C.,2010.Microalgae cultivation ina wastewater dominated by carpet mill effluents for biofuel applications.Bioresour.Technol.101,3097–3105.Deepak,V.,Kalishwaralal,K.,Ramkumarpandian,S.,Venkatesh Babu,S., Senthilkumar,S.R.,Sangiliyandi,G.,2008.Optimization of media composition for Nattokinase production by Bacillus subtilis using response surface methodology.Bioresour.Technol.99(17),8170–8174.Demirbas,A.,Demirbas,M.F.,2011.Importance of algae oil as a source of biodiesel.Energ.Conv.Manage.52,163–170.Falkowski,P.G.,Katz,M.E.,Knoll,A.H.,Quigg,A.,Raven,J.A.,Schofield,O.,Taylor,F.J.R.,2004.The evolution of modern eukaryotic phytoplankton.Science305,354–360.Grima, E.M.,Sevilla,J.M.F.,Perez,J.A.S.,Camacho, F.G.,1996.A study on simultaneous photolimitation and photoinhibition in dense microalgal cultures taking into account incident and averaged irradiances.J.Biotechnol.45,59–69.Khattar,J.I.S.,Shailza,2009.Optimization of Cd2+removal by the cyanobacterium Synechocystis pevalekii using the response surface methodology.Process Biochem.44(1),118–121.Li,Y.,Zhou,W.,Hu,B.,Min,M.,Chen,P.,Ruan,R.R.,2011.Integration of algae cultivation as biodiesel production feedstock with municipal wastewater treatment:Strains screening and significance evaluation of environmental factors.Bioresour.Technol.102(23),10861–10867.MacIntyre,H.L.,Cullen,J.J.,ing Cultures To Investigate The Physiological Ecology Of Microalgae.In:Andersen,R.A.(Ed.),Algal Culturing Techniques.Elsevier Academic Press,Burlington,pp.287–326.Mata,M.T.,Martins,A.A.,Caetano,N.S.,2010.Microalgae for biodiesel production and other applications:a review.Renew.Sustain.Energy Rev.14(1),217–232.Mishra,A.,Jha,B.,2009.Isolation and characterization of extracellular polymeric substances from micro-algae Dunaliellasalina under salt stress.Bioresour.Technol.100(13),3382–3386.Moon,N.J.,1983.Inhibition of the growth of acid tolerant yeasts by acetate,lactate and propionate and their synergistic mixtures.J.Appl.Bacteriol.55(3),453–460.Murphy,T.E.,Berberoglu,H.,2011.Effect of algae pigmentation on photobioreactor productivity and scale-up:A light transfer perspective.J.Quant.Spectrosc.Radiat.112(18),2826–2834.Pan,Y.Y.,Wang,S.T.,Chuang,L.T.,Chang,Y.W.,Chen,C.N.N.,2011.Isolation of thermo-tolerant and high lipid content green microalgae:Oil accumulation is predominantly controlled by photosystem efficiency during stress treatments in Desmodesmus.Bioresour.Technol.102(22),10510–10517.Parmar, A.,Singh,N.K.,Pandey, A.,2011.Gnansounou, E.,Madamwar, D., Cyanobacteria and microalgae:A positive prospect for biofuels.Bioresour.Technol.102(22),10163–10172.Rippka,R.,Deruelles,J.,Waterbury,J.B.,Herdman,M.,Stanier,R.Y.,1979.Generic assignments,strain histories and properties of pure cultures of Cyanobacteria.J.Gen.Microbiol.111,1–61.Schwenzfeier,A.,Wierenga,P.A.,Gruppen,H.,2011.Isolation and characterization of soluble protein from the green microalgae Tetraselmis sp.Bioresour.Technol.102(19),9121–9127.Scott,S.A.,Davey,M.P.,Dennis,J.S.,Horst,I.,Howe,C.J.,Lea-Smith,D.J.,Smith,A.G., 2010.Biodiesel from algae:challenges and prospects.Curr.Opin.Biotechnol.21, 277–286.Shen,Y.,Yuan,W.,Pei,Z.,Mao,E.,2008.Culture of microalga Botryococcus in livestock wastewater.Trans.ASABE.51(4),1395–1400.Soletto,D.,Binaghi,L.,Ferrari,L.,Lodi,A.,Carvalho,J.C.M.,Zilli,M.,Converti,A., 2008.Effects of carbon dioxide feeding rate and light intensity on the fed-batch pulse feeding cultivation of Spirulina platensis in helical photobioreactor.Biochem.Eng.J.39(2),369–375.Subhadra,B.G.,2011.Water management policies for the algal biofuel sector in the Southwestern United States.Appl.Energ.88(10),3492–3498.U.S.DOE,2010.National algal biofuels technology roadmap.U.S.Department of Energy,Office of Energy Efficiency and Renewable Energy,Biomass Program. Wahidin,S.,Idris,A.,Shaleh,S.R.M.,2013.The influence of light intensity and photoperiod on the growth and lipid content of microalgae Nannochloropsis sp.Bioresour.Technol.129,7–11.Wijffels,R.H.,Barbosa,M.J.,2010.An outlook on microalgal biofuels.Science329, 796–799.Xenopoulos,M.A.,Frost,P.C.,Elser,J.J.,2002.Joint effects of UV radiation and phosphours supply on algal growth rate and elemental composition.Ecology83(2),423–435.Yoshida,N.,Ikeda,R.,Okuno,T.,2006.Identification and characterization of heavy metal-resistant unicellular alga isolated from soil and its potential for phytoremediation.Bioresour.Technol.97(15),1843–1849.254 F.Ji et al./Bioresource Technology148(2013)249–254。