P23741025柠檬酸杆菌

Journal of Medical Microbiology Papers in Press. Published June 5, 2013 as doi:10.1099/jmm.0.057091-0Genetic characteristics of bla NDM-1-positive plasmid in C.freundii isolate separated from a clinical infectiouspatientRunning title:characteristics of bla NDM-1 plasmidContents Category: Antimicrobial Agents and Chemotherapy.Xiao-xing Du, 1 Jian-feng Wang, 1 Ying Fu, 1 Feng Zhao, 2 Yan Chen, 1 Hai-pingWang 1 and Y un-song Yu 1*1 Department of Infectious Diseases, Sir Run Run Shaw Hospital, College ofMedicine, Zhejiang University, Hangzhou, Zhejiang 310016, China2 Department of Clinical Laboratory, Sir Run Run Shaw Hospital, College ofMedicine, Zhejiang University, Hangzhou, Zhejiang 310016, China* Correspondence. Yun-song : Y u yvys119@.Tel: +86-571-8600-6142; Fax: +86-571-8600-6142Abbreviations: NDM-1, New Delhi metallo-β-lactamase-1; Inc, incompatibility group; UTI,urinary tract infection; MBL, metallo-β-lactamase; MIC, minimal inhibitory concentrations; CLSI,Clinical and laboratory Standards Institute; EUCAST, European Committee for AntimicrobialSusceptibility; IS, insertion sequence; ORFs, open reading frames;This study reports an infectious case involved by NDM-1-producing C. freundii and 1further explores the potential threat of bla NDM-1 gene by analyzing the characteristics 2of NDM-1-encoding plasmid sequence. A bla NDM-1-positive Citrobacter freundii with 3high resistance to carbapenems was separated from a clinical patient suffering from 4urinary tract infection. S1 nuclease-based plasmid analysis followed by Southern blot 5hybridization, conjugation experiment and electrotransformation confirmed that the 6bla NDM-1 gene was located on plasmid. A high-throughput sequencing on the 7bla NDM-1-postive plasmid (pCFNDM-CN) was completed, which could be generalized 8that it was a 54 kp IncX type plasmid and contained a backbone region and a variable 9region with two β-lactamase genes (bla NDM-1 and bla SHV-12). The NDM-1 composite 10transposon in the variable region was bracketed by IS26 and IS5 truncated IS Aba125, 11and shared a high sequence similarity to the bla NDM-1 surrounding structure in 12Acinetobacter spp.. Our research suggested that the NDM-1 composite transposon 13might play an essential role in the mobilization of bla NDM-1 gene from Acinetobacter 14spp. to Enterobacteriaceae.1516INTRODUCTION17Carbapenem resistance mediated by New Delhi Metallo-β-lactamase has swept 18across the globe since 2009 (Struelens et al. 2010; Yong et al. 2009; Kumarasamy et 19al. 2010; Gupta et al. 2011). Even though many reports have proved that 20Enterobacteriaceae, mostly Klebsiella pneumoniae and Escherichia coli, was the most 21prevalent species producing NDM-1 carbapenemase in Europe and United State 22(Kumarasamy et al. 2010; Ho et al. 2011; Pfeifer et al. 2011; Bonnin et al. 2012; Hu 23et al. 2012), our previous studies showed that Acinetobacter genus was the main 24genus carrying bla NDM-1 gene in China (Chen et al. 2011; Fu et al. 2012 ).25Recent studies on the bla NDM-1 gene are concentrated on the epidemiological 26characteristics by analyzing its encoding plasmids and transposon elements, and have 27implied that there are two structure regions usually composed to the bla NDM-1 28plasmids: a backbone region and a variable region (Ho et al. 2011; Hu et al. 2012).29The backbone region includes a complete array of genes for replication, plasmid 30transfer, partition and stabilization. Whereas the variable region contains a series of 31genes associated with antimicrobial agent resistance, which is responsible for the 32spreading of the resistant genes, including bla NDM-1, among bacterial population 33(Moellering 2010; Ho et al. 2011; Hu et a l. 2012).34Plasmid typing method based on replicons has been widely applied to understand 35the distribution of the bla NDM-1-harboring plasmids. With this method, some of the 36bla NDM-1-positive plasmids have been clearly classified into different incompatibility 37groups (Inc) including IncA/C, IncFI/FII, IncL/M and IncHI1, but many others were 38still untypeable, which means the features of the bla NDM-1-positive plasmids have not 39been recognized adequately yet (Carattoli et al. 2005; Kumarasamy et al. 2010;40Poirel et al. 2011a; Sole et al. 2011; Walsh et al. 2011; Dolejska et al. 2013). To 41break the limitation of methodology, plasmid sequencing is a complemented way 42which contributes more meaningful information, as well as to reveal the potential 43threat of the bla NDM-1 gene.44In this research, we reported a bla NDM-1-positive Citrobacter freundii isolate in 45China, which was separated from a patient suffering from a urinary tract infection 46(UTI). In order to reveal the epidemiological and evolution feature of the bla NDM-1 47gene, further plasmid sequencing and comparative genomic analysis were fulfilled.4849METHODS50Clinical information of the patient and determination of bla NDM-1-positive C. freundii isolate.5152We reported here a case of a 63-year-old Chinese male, who developed to urethral stricture andsuffered from dysuria and urgency in August, 2011. A C. freundii strain was isolated from the5354urine culture (over 10×5 CFU/mL) at the first day of hospitalization. The patient had not gone to55other countries like India or Pakistan, but received an operation in 2010 for prostate cancer inGuangzhou, a city very close to Hong Kong. MICs (minimal inhibitory concentrations) of 16 56antibiotics and metallo-β-lactamase (MBL) phenotype test were determined using Etest method5758(AB bioMérieux, Sweden), which displayed high resistance to carbapenems, broad-spectrum59cephalosporins, aztreonam, quinolones and gentamicin, but were susceptible to colistin,60tigecycline, amikacin and nitrofurantoin (Table 1).The susceptibility results were interpreted61according to the Clinical and Laboratory Standards Institute (CLSI) guideline 2010, and the62European Committee for Antimicrobial Susceptibility Testing (EUCAST) breakpoint was applied63for colistin and tigecycline (). The MIC breakpoint of cefoperazone/sulbactam64was referred to cefoperazone. Standard strain E. coli ATCC 25922 was used as a quality control.65According to the results of the antimicrobial susceptibility, possible resistant genes were screened66by PCR and sequencing, including extended spectrum β lactamases (ESBLs) genes (bla PER-1,67bla TEM, bla CTX-M and bla SHV), MBLs genes (bla NDM-1, bla VIM, bla IMP and bla SIM), ampC gene and68three qnr genes (qnr A, qnr B and qnr S), with primers shown in Table 2. It showed positive with69bla NDM-1, bla CTX-M-14, qnr A, bla SHV-12, bla CMY-48 gene (Table 1).70Determination of bla NDM-1-positive plasmid7172Total bacterial DNA prepared in agarose plugs was digested with S1 nuclease and separated bypulsed field gel electrophoresis (PFGE) as previous report (Chen et al. 2011). The DNA fragments7374were transferred to nylon membrane (Millipore, China), hybridized with digoxigenin-labeledbla NDM-1 probe and detected using an NBT/BCIP color detection kit (Roche Applied Sciences, 75Germany). The bla NDM-1-positive strain Acinetobacter junii ABC8415 was included as a positive7677control (Fu et al. 2012).78The mating-out assay was performed between the C. freundii isolate as a donor and E. coli J5379(Azide resistant) as a recipient. Transconjugants were selected on MH agar incorporating80ampicillin (50 mg/L) and azide (200 mg/L). Plasmid DNA was extracted using a QIAGEN81plasmid DNA midi kit (QIAGEN, Germany) and then electrotransformed into E. coli DH5αcompetent cells. The transformant was selected on MH agar plates containing ampicillin (50 mg/L) 8283(Chen et al. 2011). Both the transconjugants and the transformants were identified with Vitek 2system (bioMérieux, France), detected the MICs using Etest strips and amplified for the presence8485of the resistant genes by PCR.8687High-throughput sequencing of the bla NDM-1-positive plasmid88The plasmid DNA was sequenced by Hiseq 2000 (Illumina, USA) technology following the 2×89100-bp paired-end protocol. The derived reads were assembled using Velvet program (version 1.1)90(Zerbino et al. 2008). In order to avoid contamination from chromosomal DNA, only contigs with91sequencing coverage larger than 500 were reserved for the subsequent finishing. Gaps betweencontigs were closed by PCR.9293Genome annotation was performed using the RAST (Rapid Annotation using Subsystems94Technology) annotation website server (/rast.cgi). The BLASTx algorithmwas further used to search for protein similarities (/blast.cgi). The9596comparison of overall plasmid sequence was conducted by Artemis Comparison Tool (ACT, 97Release 11.0.0).98RESULTS AND DISCUSSION99Enterobacteriaceae producing NDM-1 carbapenemases spread widely in the world 100and represent a significant threat to public health. While in China, bla NDM-1 gene was 101detected merely in Enterobacteriaceae isolates recovered from fecal samples or rectal 102swabs or in colonized K. pneumoniae, rare was identified in clinical patients with 103infectious diseases (Wu et al. 2010; Ho et al. 2012, [Epub ahead of print]). We 104reported here a bla NDM-1-positive C. freundii isolate separated from a clinical 105infectious patient and provided more information on its genetic characteristics and 106epidemiological features by complete plasmid sequencing and comparative genomic 107analysis.108Since whole genome sequencing was applied in bla NDM-1-positive plasmids, over ten 109in Enterobacteriaceae and two in Acinetobacter spp. are completed, which show 110different sizes ranging from 35.9 kb to 288.9 kb (Poirel et al. 2011b; Sekizuka et al. 1112011), but present similar structures. It is consisted of a backbone structure charged 112for plasmid replication and transfer, and a variable region with bla NDM-1 gene (Ho et al. 1132011; Poirel et al. 2011b). Our plasmid pDFNDM-CN is 54083 bp long and possesses 11454 open reading frames (ORFs). It is composed of a 40 kb backbone region and a 14 115kb variable region (Figure 2).Several conserved gene clusters are annotated at the 116backbone region, including repB gene associated with replication and a series of pilX 117genes related to plasmid mobilization. The bla SHV-12 gene and the bla NDM-1 gene are118found exactly in the 14kb variable region. Besides, insertion sequences (IS26,119IS Aba125 and IS5) and transposases (IS26-tnpA and tnpF) responsible for horizontal120transfer are also set in this region (Figure 2). There is a copy of IS26 inserted121upstream of the bla NDM-1. While in the downstream, IS Aba125 is truncated by IS5,122which produces a 4 bp (CTAA) direct repeat (DR) and a 12 bp inverted repeat (IR)123(Figure 2). A series of conserved genes 124(tnpA-insE-groEL-cutA1-dsbC-trpF-bleo-bla NDM-1) is found in the structure of125NDM-1 composite transposon (8321bp in size) which is bracketed by IS26 and126IS Aba125. The average G+C content of the whole plasmid is 49.03%, whereas in the127NDM-1 composite transposon it is significantly higher (58%) (Figure 2).128Previous researches have proved that the NDM-1 composite transposon was usually129bracketed by insertion sequences which were responsible for the mobilization of the130bla NDM-1 gene. Those IS family members often present species specificity, such as131IS26, IS Ec33 and IS Sen occurring in Enterobacteriaceae, while IS Aba125 in132Acinetobacter spp. (Ho et al. 2011; Pfeifer et al. 2011; Poirel et al. 2011a). Different133from those plasmids harboring specific IS family, our plasmid hold a composite134transposon cohabited with Enterobacteriaceae IS family (IS26 and IS5) and135Acinetobacter IS family (IS Aba125) (Fu et al. 2012). Further comparison on the136genetic structures surrounding the bla NDM-1 gene suggests that an intact transposon137element (IS Aba125-NDM-1 composite transposon-IS Aba125) is equally discovered in138Acinetobacter spp., such as A. haemolyticus pABC7926 (accession number139JQ080305), A. baumannii AB161/07 (accession number JF949760) and A. lwoffii 140pNDM-BJ02 (accession number JQ060896), whereas the intact transposon element is 141often interrupted to fragments with different sizes in E. coli and K. pneumonia (Fu et 142al. 2012). The NDM-1 composite transposon of pCFNDM-CN shows great similarity 143(over 95%) to the above sequences of Acinetobacter spp., but lost its upstream 144IS Aba125 and is truncated at the downstream IS Aba125 by IS5. All of the evidences 145above, including the G+C content variation, suggest that the segment bracketed by the 146insE gene and the truncated IS Aba125 is probably introduced from Acinetobacter spp. 147(Figure 2).148The backbone of pCFNDM-CN presents great similarities to pIncX-SHV (accession 149number JN247852; 96% query coverage, 99% max nucleotide identity) which 150originated from a K. pneumoniae strain, but shows some differences in the insertion 151site of NDM-1 composite transposon. A 1516 bp fragment of pIncX-SHV is 152substituted by the fragment combined with the NDM-1 composite transposon and the 153IS5 truncated IS Aba125 (Figure 2). It suggests that the IS26-NDM-1 composite 154transposon-IS Aba125 region might be mediated the gene transfer from the 155Acinetobacter spp. to Enterobacteraceae.156Our results support that IncX type plasmid could not be classified successfully with 157Carattoli plasmid classification based on incompatibility group (Carattoli et al. 2005). 158There is another method through phylogenetic comparison of taxC gene developed by 159Johnson, which could clearly identify most of the four different IncX subgroups 160(IncX1 to IncX4) (Johnson et al. 2012). When it was applied on pCFNDM-CN, two 161of the reported IncX3 plasmids, pEC14_35 and pIncX-SHV, were clustered. Therefore, 162we suggest that the Johnson method could be used as a complement to identify those 163unidentified bla NDM-1 plasmids. The IncX plasmids are narrow host-range plasmids 164which are common in Enterobacteriaceae and possess diverse antimicrobial resistant 165genes such as bla TEM-52, bla TEM-1, bla SHV-11, bla CTX-M-15, bla KPC-5, qnrS1, as well as 166aphA1 (Literak et al. 2010; Johnson et al. 2012). When the NDM-1 composite 167transposon jumped from a plasmid of its ancient host,mostly Acinetobacter spp., to 168an IncX type plasmid which could mediate resistance spreading within 169Enterobacteriaceae interspecies, the bla NDM-1 gene would produce a greater threat.170In addition, there were two isolates: Providencia rettgeri (accession number 171JQ362415) and Enterobacter cloacae that also carried IncX3 subtype plasmids 172encoding the bla NDM-1 gene in Guangzhou, China (C. Zhuo, personal communication). 173Ho et al. also reported that IncX3-bla NDM-1 plasmids in Enterobacteriaceae were 174distributed in multiple areas around China, and further sequenced an IncX3 plasmid 175(pNDM-HN380, GenBank accession No. JX104760.1). Although their samples were 176separated from fecal samples or rectal swabs, their sequences presented highly 177nucleotide similarity (over 99%) with ours (Ho et al. 2012, [Epub ahead of print]). 178Considering the close distance in geography, the increasing population migration 179between Guangzhou and Hong Kong, as well as our patient being gone to Guangzhou 180for an operation a year ago, it might suggest that above plasmids might originate from 181the same progenitor, and the NDM-1-producing Enterobacteriaceae from stool might 182be contributed to the UTI. Therefore, the potential threat involved by 183bla NDM-1-positive IncX plasmids in Enterobacteriaceae isolates have appeared around 184China, and more attention should be devoted to monitoring on it.185In summary, our study reports the clinical infection case, which presented potential 186threat to public health. Through the complete sequencing of the bla NDM-1 plasmid, we 187discover that the NDM-1 composite transposon plays an essential role in the process 188of bla NDM-1 gene transfer from Acinetobacter to Enterobacteriaceae. Those 189Enterobacteriaceae isolates carrying the bla NDM-1-positive IncX plasmids should 190attribute more public concerning because it has been reported in multiple areas in 191China.192Acknowledgements193We thank Dr Chao Zhuo of the First Affiliated Hospital of Guangzhou Medical 194College, who kindly provided us with information of the two bla NDM-1-positive 195isolates.196197Funding198This work was supported by research grants from the National Natural Science 199Foundation of China (no. NSFC31170130), the State Key Program of National 200Natural Science of China (no. 81230039) and the Ministry of Health of the People’s 201Republic of China (no. 201002021).202Transparency declarations203None to declare.204205REFERENCES206207Struelens, M. J., Monnet, D. L., Magiorakos, A. P., Santos O’Connor, F, Giesecke, J & the 208European NDM-1 Survey Participants. (2010). New Delhi metallo-beta-lactamase 1-producing 209Enterobacteriaceae: emergence and response in Europe. Eurosurveillance15(46), 9-16.210Yong, D., Toleman, M. A., Giske, C. G., Cho, H. S., Sundman, K., Lee, K. & Walsh, T. R. (2009). 211Characterization of a new metallo-beta-lactamase gene, bla NDM-1, and a novel erythromycin esterase 212gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. 213Antimicrob Agents Chemother53(12), 5046-5054.214Kumarasamy, K. K., Toleman, M. A., Walsh, T. R., Bagaria, J., Butt, F., Balakrishnan, R., 215Chaudhary, U., Doumith, M., Giske, C. G., Irfan S. & other authors (2010). Emergence of a new 216antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and 217epidemiological study. Lancet Infect Dis10(9), 597-602.218Gupta, N., Limbago, B. M., Patel, J. B. & Kallen, A. J. (2011). Carbapenem-resistant 219Enterobacteriaceae: epidemiology and prevention. Clin Infect Dis53(1), 60-67.220Ho, P. L., Lo, W. U., Y eung, M. K., Lin, C. H., Chow, K. H., Ang, I., Tong, A. H., Bao, J. Y., Lok, S. 221& Lo, J. Y. (2011). Complete Sequencing of pNDM-HK Encoding NDM-1 Carbapenemase from a 222Multidrug-Resistant Escherichia coli Strain Isolated in Hong Kong. PLoS One6(3), e17989.223Pfeifer, Y., Wilharm, G., Zander, E., Wichelhaus, T. A., Gottig, S., Hunfeld, K. P., Seifert, H., 224Witte, W. & Higgins, P. G. (2011). Molecular characterization of bla NDM-1 in an Acinetobacter 225baumannii strain isolated in Germany in 2007. J Antimicrob Chemother66(9), 1998-2001.226Bonnin, R. A., Poirel, L., Naas, T., Pirs, M., Seme, K., Schrenzel, J. & Nordmann, P. (2012). 227Dissemination of New Delhi metallo-beta-lactamase-1-producing Acinetobacter baumannii in Europe. 228Clin Microbiol Infect18(9), E362-365.229Hu, H., Hu, Y., Pan, Y., Liang, H., Wang, H., Wang, X., Hao, Q., Y ang, X., Xiao, X., Luan, C. 230other authors (2012). A novel plasmid and its variant harboring both bla NDM-1 gene and T4SS in 231clinical isolates of Acinetobacter lwoffii. Antimicrob Agents Chemother56(4), 1698-1702.232Chen, Y., Zhou, Z., Jiang, Y. & Yu, Y. (2011). Emergence of NDM-1-producing Acinetobacter 233baumannii in China. J Antimicrob Chemother66(6), 1255-1259.234Fu, Y., Du, X., Ji, J., Chen, Y., Jiang, Y. & Yu, Y. (2012). Epidemiological characteristics and genetic 235structure of bla NDM-1 in non-baumannii Acinetobacter spp. in China. J Antimicrob Chemother67(9), 2362114-2122.237Moellering, R. C., Jr. (2010). NDM-1—a cause for worldwide concern. N Engl J Med363(25), 2382377-2379.239Carattoli, A., Bertini, A., Villa, L., Falbo, V., Hopkins, K. L. & Threlfall, E. J. (2005). Identification 240of plasmids by PCR-based replicon typing. J Microbiol Methods63(3), 219-228.241Poirel, L., Dortet L., Bernabeu, S. & Nordmann, P. (2011a). Genetic features of bla NDM-1-positive 242Enterobacteriaceae. Antimicrob Agents Chemother55(11), 5403-5407.243Sole, M., Pitart, C., Roca, I., Fabrega, A., Salvador, P., Munoz, L., Oliveira, I., Gascon, J., Marco, 244F. & Vila, J. (2011). First description of an Escherichia coli strain producing NDM-1 carbapenemase 245in Spain. Antimicrob Agents Chemother55(9), 4402-4404.246Walsh, T. R., Weeks, J., Livermore, D. M. & Toleman, M. A. (2011). Dissemination of NDM-1 247positive bacteria in the New Delhi environment and its implications for human health: an 248environmental point prevalence study. Lancet Infect Dis11(5), 355-362.249Dolejska, M., Villa, L., Poirel, L., Nordmann, P. & Carattoli, A. (2013). Complete sequencing of an250IncHI1 plasmid encoding the carbapenemase NDM-1, the ArmA 16S RNA methylase and a 251resistance-nodulation-cell division/multidrug efflux pump. J Antimicrob Chemother68(1), 34-39.252CLSI (2012).Performance Standards for Antimicrobial Susceptibility Testing, 22nd Informational 253Supplement. M100-S22. Wayne, PA: Clinical and Laboratory Standards Institut.254Zerbino, D. R. & Birney, E. (2008). V elvet: algorithms for de novo short read assembly using de 255Bruijn graphs. Genome Res18(5), 821-829.256Wu, H. S., Chen, T. L., Chen, I. C., Huang, M. S., Wang, F. D., Fung, C. P. & Lee, S. D. (2010). 257First identification of a patient colonized with Klebsiella pneumoniae Carrying bla NDM-1 in Taiwan. J 258Chin Med Assoc73(11), 596-598.259Ho, P. L. , Li, Z., Lo, W. U., Cheung, Y. Y., Lin, C. H., Sham, P. C., Cheng, V. C., Ng, T. K., Que, T. 260L. & Chow, K. H. (2012, [Epub ahead of print]). Identification and characterization of a novel 261incompatibility group X3 plasmid carrying bla NDM-1 in Enterobacteriaceae isolates with 262epidemiological links to multiple geographical areas in China. Emerging microbes and infections e39. 263Poirel, L., Bonnin, R. A. & Nordmann, P. (2011b). Analysis of the resistome of a multidrug-resistant 264NDM-1-producing Escherichia coli by high-throughput genome sequencing. Antimicrob Agents 265Chemother55(9), 4224-4229.266Sekizuka, T., Matsui, M., Y amane, K., Takeuchi, F., Ohnishi, M., Hishinuma, A., Arakawa, Y. & 267Kuroda, M. (2011). Complete sequencing of the bla NDM-1-positive IncA/C plasmid from Escherichia 268coli ST38 isolate suggests a possible origin from plant pathogens. PLoS One6(9), e25334.269Literak, I., Dolejska, M., Janoszowska, D., Hrusakova, J., Meissner, W., Rzyska, H., Bzoma, S. & 270Cizek, A. (2010). Antibiotic-resistant Escherichia coli bacteria, including strains with genes encoding 271the extended-spectrum beta-lactamase and QnrS, in waterbirds on the Baltic Sea Coast of Poland. Appl 272Environ Microbiol76(24), 8126-8134.273Johnson, T. J., Bielak, E. M., Fortini, D., Hansen, L. H., Hasman, H., Debroy, C., Nolan, L. K. & 274Carattoli, A. (2012). Expansion of the IncX plasmid family for improved identification and typing of 275novel plasmids in drug-resistant Enterobacteriaceae. Plasmid68(1), 43-50.276Bae, I. K., Jang, S. J., Kim, J., Jeong, S. H., Cho, B. & Lee, K. (2011). Interspecies dissemination of 277the bla gene encoding PER-1 extended-spectrum beta-lactamase. Antimicrob Agents Chemother55(3), 2781305-1307.279Zhang, R., Zhou, H. W., Cai, J. C., Zhang, J., Chen, G. X., Nasu, M. & Xie, X. Y. (2011). Serotypes 280and extended-spectrum beta-lactamase types of clinical isolates of Shigella spp. from the Zhejiang 281province of China. Diagn Microbiol Infect Dis69(1), 98-104.282Lee, M. F., Peng, C. F., Hsu, H. J. & Chen, Y. H. (2008). Molecular characterisation of the 283metallo-beta-lactamase genes in imipenem-resistant Gram-negative bacteria from a university hospital 284in southern Taiwan. Int J Antimicrob Agents32(6), 475-480.285Lee, K., Yum, J. H., Yong, D., Lee, H. M., Kim, H. D., Docquier, J. D., Rossolini, G. M. & Chong, 286Y. (2005). Novel acquired metallo-beta-lactamase gene, bla SIM-1, in a class 1 integron from 287Acinetobacter baumannii clinical isolates from Korea. Antimicrob Agents Chemother49(11), 2884485-4491.Table1. Antimicrobial susceptibility pattern and molecular characteristics of theNDM-1-producing C. freundiiAntimicrobial agentsMIC (mg/L)C. freundii C. freundii -J53 E.coli J53 C. freundii -DH5α E.coli DH5αSAM >256 >256 8 >256 3 TZP >256>256 1.5 128 1 CAZ >256 >256 0.125>256 0.19 FEP 256 24 0.0324 0.016 CTX >256 >256 0.032>256 0.064 CPS2/1 >256 >256 0.19 32 1IPM >32 3 0.252 0.19 MEM >32 2 0.13 3 0.02 CST 0.5 0.5 0.5 0.125 0.125 GEN 64 0.25 0.25 0.125 0.125 AMK 2 1.5 1.5 0.5 0.5 TGC 0.5 0.125 0.25 0.125 0.125 MIN 24 2 1.5 0.38 0.38 CIP 16 0.008 0.0080.008 0.008 ATM 48 32 0.03 12 0.05 NIT 12 4 3 0.125 0.094Resistant genes bla NDM-1,bla CTX-M-14,qnr A,bla SHV-12,bla CMY-48bla NDM-1, bla SHV-12 ND bla NDM-1, bla SHV-12 NDSAM, ampicillin/sulbactam; TZP, piperacillin/tazobactam; CAZ, ceftazidime; FEP, cefepime; CTX, cefotaxime; CPS2/1, cefoperazone/sulbactam 2:1; IPM, imipenem; MEM, meropenem; CST, colistin; GEN, gentamicin; AMK, amikacin; TGC, tigecycline; MIN, minocycline; CIP, ciprofloxacin; ATM, aztreonam; NIT, nitrofurantoin. ND: not detected.Table 2. Primers for antimicrobial resistance genes detectionTarget gene(s) Primers Sequence(5'→3') productionlength (bp)Referencebla PER-1PER-F CCTGACGATCTGGAACCTTT 485 (Bae et al. 2011) PER-R TGGTCCTGTGGTGGTTTCbla TEM cluster TEM-F TCGGGGAAATGTGCG 972 (Zhang et al. 2011) TEM-R TGCTTAATCAGTGAGGCACCbla CTX-M-1 cluster CTX-M-1F CAGCGCTTTTGCCGTCTAAG 944 (Zhang et al. 2011) CTX-M-1R GGCCCATGGTTAAAAAATCACTGCbla CTX-M-2 cluster CTX-M-2F GCATTCGCCGCTCAATGTTA 962 (Zhang et al. 2011) CTX-M-2R GGTTCGTTGCAAGACAAGACbla CTX-M-8 cluster CTX-M-8F ACTTCAGCCACACGGATTCA 878 (Zhang et al. 2011) CTX-M-8R CGAGTACGTCACGACGACTTbla CTX-M-9 cluster CTX-M-9F GTTACAGCCCTTCGGCGATGATTC 877 (Zhang et al. 2011) CTX-M-9R GCGCATGGTGACAAAGAGAGTGCAAbla SHV cluster SHV-F GCCTTTATCGGCCTTCACTCAAG 898 (Zhang et al. 2011) SHV-R TTAGCGTTGCCAGTGCTCGATCAbla NDM-1NDM-up168 GAATGTCTGGCAGCACACTT 480 (Chen et al. 2011) NDM-dw647 TTGGCCTTGCTGTCCTTGATbla VIM cluster VIM-F AAAGTTATGCCGCACTCACC 864 (Lee et al. 2008) VIM-R TGCAACTTCATGTTATGCCGbla IMP cluster IMP-F CTACCGCAGCAGAGTCTTTG 587 (Lee et al. 2008) IMP-R AACCAGTTTTGCCTTACCATbla SIM SIM-F TACAAGGGATTCGGCATCG 571 (Lee et al. 2005) SIM-R TAATGGCCTGTTCCCATGTGampC ampC-F CGGGCAATACACCAAAAGAC 1049 This study ampC-R CCTTAATGCGCTCTTCATTTGGqnrA qnrA-F AAGGAAGCCGTATGGATATT 670 This study qnrA-R AGCTAATCCGGCAGCACTATqnrB qnrB-F CGACCTGAGCGGCACTGAAT 515 This study qnrB-R TGAGCAACGATGCCTGGTAGqnrS qnrS-F ACCTTCACCGCTTGCACATT 571 This study qnrS-R CCAGTGCTTCGAGAATCAGT。