2006-Endocrinology-The Mouse Testis Is the Source of Various Serine Proteases and Serine Proteinase

The Mouse Testis Is the Source of Various SerineProteases and Serine Proteinase Inhibitors (SERPINs):Serine Proteases and SERPINs Identified in Leydig Cells Are under Gonadotropin RegulationFanny Odet,Ade ´lie Verot,and Brigitte Le Magueresse-BattistoniInstitut National de la Sante ´et de la Recherche Me ´dicale,Unite ´418,Institut National de Recherche et de Se ´curite ´Unite ´Mixte de Recherche 1245,and Universite ´Lyon 1,Hopital Debrousse,69322Lyon cedex 05,FranceThe occurrence of various serine proteinases and serine pro-teinases inhibitors (SERPINs)was investigated by RT-PCR in whole testes of 1-,3-,and 8-wk-old mice in crude and enriched germ cell fractions,mouse Leydig tumor cells (mLTC-1),and primary cultures of 3-and 8-wk-old enriched fractions of Ley-dig cells and 3-wk-old Sertoli cells.New members were iden-tified in the testis protease repertoire.Within the Leydig rep-ertoire,a PCR product was found for plasminogen activators urokinase plasminogen activator (uPA)and tissue plasmino-gen activator (8-wk-old cells),matriptase-2(mLTC-1),kal-likrein-21,SERPINA5,SERPINB2(primary cultures),and serine peptidase inhibitor Kunitz type 2(SPINT2).The go-nadotropin regulation was explored by semiquantitative RT-PCR,using steroidogenic acute regulatory protein (StAR)as a positive control.Matriptase-2,kallikrein-21,SPINT2,and SERPINA5were down-regulated,whereas uPA and its recep-tor were up-regulated by human chorionic gonadotropin (hCG)via cAMP in the mLTC-1cells.Positive effects were observed transiently after 1–8h of hCG exposure,and nega-tive effects,first evidenced after 6h,lasted 48h.The hCG-induced effects were confirmed in primary cultures.In addi-tion,SERPINB2was augmented by hCG in primary cultures.Addition of either trypsin or protease inhibitors did not alter the hCG-induced surge of StAR.Because hCG regulated pro-teases and SERPINs (whereas testosterone did not),it could alter the proteolytic balance of Leydig cells and consequently the metabolism of extracellular matrix components.There-fore,even though a direct interplay between the early hCG-induced surge of uPA and StAR is unlikely,our data to-gether with the literature suggest that extracellular matrix proteins alter Leydig cell steroidogenesis.(Endocrinology 147:4374–4383,2006)ANUMBER OF important processes that regulate the activity and fate of many proteins are strictly depen-dent on proteolytic processing events.The serine proteinase family is one of the oldest characterized and largest families of proteolytic genes (227members in the mouse)(1,2),which has well-characterized roles in diverse cellular activities in-cluding blood coagulation,platelet activation,fibrinolysis and thrombolysis,extracellular matrix (ECM)remodeling,and cancer invasion (3).The serine proteinases can be further subdivided into 16families,among them the plasminogen activators,transmembrane serine proteinases,and kal-likreins.Serine proteinase activity is regulated by serine pro-teinase inhibitors (SERPINs).The SERPINs belong to an ex-panding superfamily of structurally similar but functionally diverse proteins,and most of them share a substrate suicide mechanism irreversibly inactivating the SERPINs (4–6).The testis is a reproductive organ that serves two decisive functions,the production of spermatozoa taking place in the seminiferous tubules and the synthesis and secretion of tes-tosterone by the Leydig cells located in the interstitium.Spermatogenesis is hormonally regulated,pituitary gonad-otropins positively regulating Leydig and Sertoli cell secre-tions through LH and FSH,respectively.Testosterone,pro-duced as a result of LH action on Leydig cells,acts via androgen receptors localized on Sertoli,peritubular,and Leydig cells.Sertoli cells play several key roles in spermat-ogenesis.They are targets for FSH and testosterone,these hormones being responsible for the initiation and mainte-nance of spermatogenesis.Moreover,together with the peri-tubular cells,they also form the cytoarchitectural scaffolding of the tubule,providing structural and nutritional support for the developing germinal cells (7–10).In an attempt to elucidate the role of proteinases and proteinase inhibitors in testicular physiology,we examined the presence of various serine proteinases and SERPINs in the whole testes of mice as well as isolated testicular cells.For this purpose,we used total RNA recovered from whole testes of 1-,3-,and 8-wk-old mice,from crude and enriched germ cell fractions,primary cultures of 3-wk-old Sertoli cells,3-and 8-wk-old enriched preparations of Leydig cells,and mouse Leydig tumor cells (mLTC-1).Because Leydig cells were found to express several proteinases and SERPINs,we determined whether they were under gonadotropin regula-tion.We also examined the influence of testosterone.First Published Online June 1,2006Abbreviations:aPC,Activated protein C;ECM,extracellular matrix;hCG,human chorionic gonadotropin;HGFA,hepatocyte growth factor activator;HPRT,hypoxanthine phosphoribosyl transferase;mLTC,mouse Leydig tumor cell;PA,plasminogen activator;PC,protein C;PCI,protein C inhibitor;SERPIN,serine proteinase inhibitor;SPINT1or 2,serine peptidase inhibitor Kunitz type 1or 2;StAR,steroidogenic acute regulatory protein;tPA,tissue plasminogen activator;uPA,urokinase plasminogen activator;uPAR,uPA receptor.Endocrinology is published monthly by The Endocrine Society (),the foremost professional society serving the endocrine community.0013-7227/06/$15.00/0Endocrinology 147(9):4374–4383Printed in U.S.A.Copyright ©2006by The Endocrine Societydoi:10.1210/en.2006-04844374Materials and MethodsAnimals,tissues,and cell preparationsCD-1mice were purchased from Elevage Janvier(Le Genest,France). Testes were collected from1-,3-,and8-wk-old mice.Enriched prepa-rations of pachytene spermatocytes and early spermatids(75–80%en-richment)were obtained after centrifugal elutriation of a crude germ cell preparation recovered from adult mice testes by trypsination(11).Once harvested,testes or cells were immediately stored atϪ70C and pro-cessed for RNA analysis.Experiments were conducted according to the Guide for the Care and Use of Laboratory Animals.Leydig-enriched fractions and Sertoli cells were isolated from3-wk-old mice testes and cultured in Ham’s F12-DMEM(Life Technologies, Grand Island,NY)at32C in a humidified atmosphere of5%CO2as previously described(12),except that a hyaluronidase treatment(0.1%, 20min,32C)was introduced after the second collagenase digestion to reduce peritubular cell contamination in the Sertoli cell fraction(13). Leydig cells were recovered in the supernatant of the first collagenase digestion,and the resulting suspension was hypotonic treated to elim-inate the contaminating germ cells,as described recently(14).After several washes,the cell suspension was plated in12-well plates(50,000 cells/well).Enrichment of the cell suspension was higher than80%as judged by3␤-hydroxysteroid dehydrogenase immunostaining(not shown).At the end of the enzymic procedure,the Sertoli cell suspension was washed with fresh culture medium,and cells were seeded in6-well plates at a ratio of1ϫ106viable cells/well in Ham’s F12-DMEM.They were cultured for2d.At that time,the purity of the cultures was higher than90%,and contamination was mainly due to residual germ cells(an average of5–7%)(not shown).Leydig-enriched fractions were also isolated from8-wk-old mice testes and cultured in Ham’s F12-DMEM at32C in a5%CO2incubator as described for the3-wk-old testes.They were recovered in the super-natant of the first collagenase digestion,and the resulting suspension was harvestly washed,filtered through a45-mm nylon mesh and hy-potonic treated.After several washes,the cell suspension was plated in 12-well plates(50,000cells/well).Enrichment of the cell suspension examined on the next day was higher than70%as judged by3␤-hy-droxysteroid dehydrogenase immunostaining(not shown).Cell line culturesThe immortalized Leydig cell mLTC-1line was kindly provided by D.M.Stocco(Texas Tech,Lubbock,TX).The mLTC-1cells were culti-vated at37C in a5%CO2incubator.Culture medium was a RPMI1640 medium(Sigma-Aldrich Corp.,St.Louis,MO)supplemented with10% fetal calf serum until cells reached subconfluency(70%),as described (15).Serum was then omitted,cells were rinsed abundantly,and fresh medium was replaced.Cell treatmentIn the relevant experiments,testosterone(0.1␮m),human chorionic gonadotropin(hCG;from1to100ng/ml;Organon,Puteaux,France), bu2cAMP(1m m),actinomycin D(5␮g/ml),cycloheximide(50␮g/ml), trypsin(from1to1000ng/ml),or proteases inhibitors(a cocktail of aprotinin and leupeptin at100␮m each)(all from Sigma)were added to the cultures at the doses and for the time periods indicated.RNA extraction,RT-PCR,and semiquantitative RT-PCR Procedures for RNA extraction and RT-PCR have been described elsewhere(16).Specific primers were designed using the Gene-Jockey sequence processor(Biosoft,Cambridge,Cambridgeshire,UK),and the optimal temperature of annealing was defined for each couple of prim-ers(Table1).Negative controls contained water instead of cDNA.PCR with no reverse transcription gave no product,eliminating the possi-bility of a genomic DNA contamination in the RNA preparations.Am-plified cDNAs were visualized in a1.5%agarose gel stained with ethidium bromide.A DNA ladder(Promega,Charbonnie`res,France) was loaded on each gel,and18S was used to ensure equal loading.PCR products were sequenced by Biofidal(Lyon,France).Conditions for reliable semiquantitative RT-PCR were optimized for each series of primers in the presence of␣-33P dATP(0.75␮Ci;2500Ci/mmol;Am-ersham Pharmacia Biotech Europe GmbH,Orsay,France),as described elsewhere(17,18).The PCR products were separated on8%polyacryl-amide gel electrophoresis in1ϫTris borate EDTA(TBE)buffer.Gels were transferred to filter paper,dried,and exposed to Kodak biomax MR1films(Sigma).The band densities were determined by scanning densitometric analysis(Scion image␤,4.03;Scion Corp.).Densitometry data were normalized using hypoxanthine phosphoribosyl transferase (HPRT).Protein extraction and analysisGonadal proteins were extracted in PBS containing1%Nonidet P-40 and5m m EDTA,as previously described(16).For plasminogen zy-mography,10-fold concentrated proteins were electrophoresed at4C on 10%PAGE in the absence of any reducing agent.After electrophoresis, sodium dodecyl sulfate was removed from the gel by exchange in Triton X-100(two washes,30min each,at room temperature in2.5%Triton X-100,followed by three washes,30min each,in distilled water).The gel was subsequently placed on a casein-agar-plasminogen underlay asTABLE1.Nomenclature and selected information on the serine proteinases and SERPINs hereby studied(1)Nomenclature Selected information Ref. Serine proteinasesHGFA Activates the conversion of proHGF into active HGF20 Hepsin Transmembrane serine proteinase which may also activate proHGF21 Kallikrein-21Specifically expressed in Leydig cells in testis where it degrades at least fibronectin22 Matriptase-2Transmembrane serine proteinase showing degrading activity againsttype I collagen and fibronectin23 PAtPA uPA Catalyse the conversion of plasminogen into plasmin,a serine proteinase with alarge spectrum of activity toward latent proteinases and ECM components3aPC Anticoagulant previously identified in the testis24Targeted proteinases among those studiedSERPINsHGFA inhibitor(HAI)SPINT1(HAI-1)HGFA,matriptase-2,hepsin20–23 SPINT2(HAI-2)HGFA,kallikrein,hepsin and plasmin,but not uPA25–27 PA inhibitor(PAI)SERPINE1(PAI-1)uPA,aPC,tPA,plasminSERPINB2(PAI-2)uPA,tPA(poor inhibitor)SERPINA5(PAI-3or PCI)aPC,uPA,tPA,kallikrein3–6 SERPINE2(Protease nexin1,or PN-1)uPA,tPA,plasminOdet et al.•Serine Proteinases,Serpins,and Mouse Testis Endocrinology,September2006,147(9):4374–43834375previously described(18,19).Plasminogen-degrading activity was vi-sualized after incubation at37C for12h,and gels were scanned. SDS-PAGE(10%)and Western blotting were carried out as described elsewhere(16–18),using the concentrated culture media also assayed in plasminogen zymography.A rabbit polyclonal antibody was used against recombinant mouse protein C inhibitor(PCI or SERPINA5;di-lution1:1000;a gift from M.Geiger,Department of Vascular Biology and Thrombosis Research,University of Vienna,Vienna,Austria)and was detected by an antirabbit IgG(dilution1:10,000)conjugated to peroxy-dase(Jackson ImmunoResearch,Baltimore,MD).Precision protein stan-dards(Bio-Rad Laboratories,Hercules,CA)were loaded for estimation of the molecular masses of the bands,which were revealed using an ECLϩchemiluminescent detection system(Amersham Pharmacia Biotech).Data analysisThe densitometric data are given as the meanϮsem(nϭ3–4),and experiments were repeated at least three times(twice for the8-wk-old preparations of Leydig cells).The significance of the results was deter-mined by ANOVA followed by a Mann-Whitney U test.Differences were considered significant at PϽ0.05.ResultsRT-PCR screening of serine proteinases and SERPINs Selected information and nomenclature for the seven serine proteinases and six SERPINs studied are summarized in Table1,and the list and sequences of the designed specific primers for PCR studies are described in Table2.Total RNA was recovered from1-,3-,or8-wk-old testes from total germ cells or enriched fractions in pachytene spermatocytes or early spermatids;the mLTC-1;Leydig-enriched fractions re-covered from3-and8-wk-old mice testes;and3-wk-old Sertoli cells,which had been cultured for2d in basal con-ditions.A PCR product of the right size and sequence(not shown)was detected for each of the serine proteinases and SERPINs(Fig.1).Plasminogen activators(PAs)were among the most abundant serine proteases within the testis at the three ages investigated,and tissue plasminogen activator (tPA)was more abundant than urokinase plasminogen ac-tivator(uPA).SERPINA5,serine peptidase inhibitor Kunitz type1(SPINT1),and SPINT2were the most abundant SERPINs within the testis.Germ cells had the smallest rep-ertoire with hepatocyte growth factor activator(HGFA),ac-tivated protein C(PC),SERPINA5,SPINT1,and the longest form of SPINT2.The weak bands seen for tPA and SERPINE2 in the nonelutriated fraction probably resulted from a so-matic contamination because they were not detected in the enriched fractions(Fig.1).These data extend previous results showing activated PC(aPC)in mouse germ cells(24)and SPINT2in human germ cells(27).Primary cultures of Leydig-enriched fractions as well as mLTC-1cells exhibited a PCR product for six of the13serine proteases and SERPINs investigated,including the two plas-minogen activators,matriptase-2,kallikrein-21,SERPINB2, SERPINA5,and SPINT2.No signals were seen with primers designed against activated protein C,HGFA,or hepsin(Fig.1).Interestingly,the PCR band for matriptase-2was detected in mLTC-1but not Leydig-enriched fractions,Sertoli cells,or germ cells.Thus,the origin of the weak band in whole testes is yet unknown.Inversely,a PCR band for SERPINB2was found in Leydig-enriched fractions but not mLTC-1cells. Finally,a PCR band for tPA was found in8-wk-old enriched fractions of Leydig cells(Fig.1).All these data on Leydig cells are original except for tPA(28)and kallikrein-21(22).Sertoli cells exhibited stronger PCR products corresponding to uPA and tPA than Leydig cells.A weak PCR product correspond-ing to hepsin was also found in Sertoli cells.Regarding the SERPINs,Sertoli cells exhibited a PCR product for each of them.In addition,PCR products were stronger in Sertoli cells than Leydig cells,with the exception of SERPINB2(Fig.1). Addition of hCG altered the expression of proteinases and SERPINs in the mLTC-1cellsLeydig mLTC-1cells were cultured to80%confluence, serum starved,and then treated with hCG at1,10,or100 ng/ml for6h.Cells were then scraped,total RNA was extracted,and RT-PCR experiments performed.PrimersTABLE2.List and sequence of the designed specific primers for PCR studiesAccession no.Primers(5Ј–3Ј)Size(bp)T Opt(C) Sense AntisenseHPRT J00423CCTGCTGGATTACATTAAAGCACTG GTCAAGGGCATATCCAACAACAAAC35465 18S X00686GGAATAATGGAATAGGACCG TCTGTCAATCCTGTCCGTGTCC43561 StAR L36062GCATACTCAACAACCAGGAAGG CTGGTTGATGATTGTCTTCGGC51166 AR NM_013476TACATGTGGTCAAGTGGG TGTGTGGAAAATAGATGGG51166 Serine proteinases and receptor for uPAuPA NM_008873TGTCAGAACGGAGGTGTATGCG TGTTCTTCTGGTAGATGGCTGC50765 uPAR X62700GAATGGCAAGATGATAGAGAGC AACACTGGAAGCCATTCGGTGG48969 tPA J03520TATTGTCGGAATCCAGATGG AACGAACCTGACACTGGAGTCG46163 Matriptase-2AY240929CTCTCTGGACTACGGCTTGGCGCTC TGGAGGCCACAGTCACAGTGTTGC59665 Hepsin NM_008281TCATCTCTGTATGTGACTGTCC TAGAGAGGTGGACCAAGGCAA39565 HGFA AF224724ACTTCTTCAACCGCACCACG CTACTACGGTATGTCCATTCGG45766 Kallikrein-21NM_010642GAACCTGGACACCTGTTACC CGTAGTAACATCAGGTCATTGC39666 aPC NM_008934CCAAGGATAGTCAACGGAACGC CTGCCCATCCTTTGATTCTGTCGC43366 SERPINsE1M33960CCAACAAGAGCCAATCACAAGG GAAAGGTGGAGACTCTTC50363 B2NM_011111TCCTTGAATGTGCTGAAGAAGC GACCACAACATCATCTTCATCC45169 A5AH006766ACAACTATGTAGCCAAGCAGACC TCCTCCACCTGCTTCATCTTGC32465 E2NM_009255TGAAGTCAGTGAAGATGGAACC CCTGCTCATCCTTCACTACAGC46458 SPINT1AF099018TGACTATCACTGTGCTAACTGC TAGGAAGAACCTCTACGGTGCC59265 SPINT2AF099016AATGGAGCCGACTCTTCTGTCC CTACTCCGTCTGGTATCTCC35665The optimal temperature(TOpt )for annealing,the size of the expected PCR fragments,and the source for the design of the primers arereported.The number of cycles was determined for each set of primers.It ranged from19to26.4376Endocrinology,September2006,147(9):4374–4383Odet et al.•Serine Proteinases,Serpins,and Mouse Testisused included those specific for uPA,kallikrein-21,matriptase-2,SPINT2,SERPINA5,HPRT as a house keeping gene,and the steroidogenic acute regulatory protein (StAR)to ensure that Leydig cells responded to hCG under our experimental conditions.Addition of hCG resulted in a sig-nificant enhancement of StAR at the three doses,and 100ng/ml induced a 2.5-fold increase (P Ͻ0.05).Interestingly,hCG positively regulated the expression levels of uPA and down-regulated the expression levels of matriptase-2,kal-likrein-21,SERPINA5,and SPINT2(Fig.2).These effects depended on the doses of hCG,and a significant (P Ͻ0.05)effect was obtained with the dose of 100ng/ml.Indeed,uPA levels increased 4.2-fold,whereas levels of kallikrein-21,matriptase-2,SPINT2,and SERPINA5were halved in the hCG-treated cultures,compared with the untreated cultures.Gonadotropins positively regulate the expression of uPA,its receptor (uPAR),and the uPA enzymatic activity via cAMPThe addition of hCG at a dose of 100ng/ml for 2h,which significantly increased (2.5-fold increase;P Ͻ0.05)the ex-pression of StAR,also significantly enhanced (a 5.2-fold in-crease;P Ͻ0.05)the expression of uPA (Fig.3).The hCG-induced expression of uPA was maintained after 8h (a 2-fold increase;P Ͻ0.05),but it was no longer observed after 24h of stimulation.The time-course effects of hCG were mirrored by the addition of bu 2cAMP 1m m ,indicating the involve-ment of the protein kinase A (Fig.3A).We next examined the expression levels of the uPAR because uPAR dictates the site and extent of proteolysis of uPA (3).Addition of hCG or bu 2cAMP was found to exert a significant but transient stim-ulatory effect on the expression of uPAR.The effect was observed after 2h (a 3-and 2.9-fold increase,respectively;P Ͻ0.05)but not after 8or 24h of stimulation (Fig.3A).The role of transcription and ongoing protein synthesis in the hCG-induced uPA mRNA levels was evaluated.For this purpose,mLTC-1cells were pretreated for 30min with ac-tinomycin-D or cycloheximide and stimulated with hCG 100ng/ml for 6h.The results indicate that the presence of the inhibitor of either RNA or protein synthesis abolishes the hCG-induced positive regulation of uPA and StAR (Fig.3B).The biological activity of uPA was examined by zymog-raphy in culture media from mLTC-1treated for 24h with hCG or bu 2cAMP.We observed a strong enhancement of the uPA lytic band in the stimulated cells.No tPA lytic band was detectable (Fig.3C).Gonadotropins negatively regulate the expression of matriptase-2,kallikrein-21,SERPINA5,and SPINT2via cAMPMatriptase-2,kallikrein-21,SERPINA5,and SPINT2were decreased in hCG-treated cells after a kinetics different from that described for uPA and uPAR (Fig.4A),and noeffectsF IG .1.RT-PCR analysis of various serine proteinases and SERPINs in 1-,3-,8-wk-old mice testes;germ cells either from total germinal cells (total)or fractions enriched in pachytene spermatocytes (scytes)or early spermatids (stids);mLTC-1cells;Leydig-enriched fractions recovered from 3-and 8-wk-old mice testes;or Sertoli cells recovered from 3-wk-old mice testes (SC 3-wk),which had been cultured for 2d in basal conditions.The set of primers used is listed in Table 2.RT-PCR studies were also conducted using primers directed against 18S to ensure that equal amounts of material were used.A DNA ladder was included in each gel for accurate determination of the size of the PCR product (not shown).Mat.-2,Matriptase-2;kall.-21,kal-likrein-21.F IG .2.Regulation of StAR,uPA,kallikrein-21,matriptase-2,SPINT2,and SERPINA5in the mLTC-1cells by hCG.Cells were cultured for 6h in the absence or presence of three different doses of hCG (1,10,and 100ng/ml,respectively).Three experiments were performed and a representative autoradiograph is shown.HPRT was used as a control in the RT-PCR studies.Odet et al.•Serine Proteinases,Serpins,and Mouse Testis Endocrinology,September 2006,147(9):4374–43834377were observed after 2h of stimulation.However,in cells treated for 8h with hCG,matriptase-2,kallikrein-21,SERPINA5,and SPINT2were significantly decreased (P Ͻ0.05),and their levels represented 33,40,36,and 50%of their respective control.After 24h of hCG exposure,the inhibition was stronger than that after 8h (except for SPINT2),with levels of matriptase-2,kallikrein-21,and SERPINA5de-creased to baseline levels.The kinetics of the effects induced by hCG were mimicked by the addition of bu 2cAMP,indi-cating the involvement of the protein kinase A (Fig.4).To determine the reversibility of the hCG-induced inhi-bition,mLTC-1cells were treated for 16h with hCG 100ng/ml,after which cells were washed and fresh culture me-dium was added.After 24h,cells were scraped and total RNA was extracted for RT-PCR studies.A densitometry analysis indicated a full recovery of the expression levels of matriptase-2and kallikrein-21,whereas the expression levels of SERPINA5and SPINT2had only partially recovered (Fig.4B).After 48h,half and full recovery of the expression levels of SERPINA5and SPINT2were observed,respectively (not shown).By Western blotting,a single protein,comigrating at 46kDa with proteins extracted from seminal vesicles rich in PCI (24),was detected in testis extracts as well as the culture media of mLTC-1.Addition of hCG 100ng/ml or bu 2cAMP 1m m for 24h resulted in a strong decrease in the 46-kDa migrating band corresponding to PCI (Fig.4C).Testosterone did not influence the expression of proteases and SERPINs in the mLTC-1cellsWe also investigated a possible influence of testosterone 0.1␮m added for 2,8,or 24h.Androgen receptors werefirst evidenced by RT-PCR (not shown).No effects of tes-tosterone were observed on uPA,matriptase-2,kallikrein-21,SERPINA5,or SPINT2(not shown).Gonadotropins regulate serine proteases and SERPINs expressed in primary culturesBecause mLTC-1cells were tumor cells,we wished to examine whether hCG and testosterone could regulate serine proteases and SERPINs expressed in normal Leydig cells.For this purpose,enriched fractions of Leydig cells were isolated from 3-and 8-wk-old mouse testes,cultured for 2d,and stimulated with hCG 100ng/ml or testosterone 0.1␮m for 2,24,or 48h (Fig.5).Androgen receptors were first evidenced by RT-PCR (not shown).The serine proteases and SERPINs examined include uPA,kallikrein-21,SERPINA5,SPINT2,and SERPINB2.tPA was also studied using the 8-wk-old preparations,but levels in the culture were too weak to be quantified (not shown).The data presented indicate that hCG significantly enhanced uPA and SERPINB2and that kallikrein-21,SERPINA5,and SPINT2were down-regulated by hCG in both types of primary cultures,i.e.from the 3-and 8-wk-old preparations (Fig.5).After 2h of stimulation,fold increases of uPA were 2.5and 4.9(P Ͻ0.05),respectively for the 3-and 8-wk-old preparations in primary cultures.No effects of hCG were observed in long-term cultures (24or 48h)(Fig.5A).The addition of hCG significantly increased SERPINB2levels after 24h of stimulation (a 4.1-fold increase;P Ͻ0.05),using the 8-wk-old preparations.The fold increase was 1.6(P Ͻ0.05)after 48h of stimulation using the 3-wk-old preparations.No significant effects were observed when the cells were treated for 2h with hCG (Fig.5A).The effects induced by hCG in primary cultures from the 8-wk-oldprep-F IG .3.Effects of hCG and bu 2cAMP on the expression levels of StAR,uPA,uPAR (RT-PCR),and uPA biological ac-tivity (plasminogen zymography)in mLTC-1cells.A,mLTC-1cells were stimulated for 2,8,or 24h in the pres-ence of hCG 100ng/ml or bu 2cAMP 1m M .C,Control,i.e.untreated cells.B,mLTC-1cells were pretreated for 30min with actinomycin D (Act)or cyclohexi-mide (CHX)and stimulated with hCG for 6h.Representative autoradiographs are shown in A and B.Autoradiographs were scanned and the expression was normal-ized to the HPRT signal.Values are the mean ϮSEM of n ϭ3;*,P Ͻ0.05,com-pared with untreated dishes.C,Zymo-graphic analysis of the culture media of mLTC-1cells stimulated for 24h in the presence or absence of 100ng/ml hCG or bu 2cAMP 1m M .A representative zymo-gram of four experiments performed is shown.The uPA lytic band is noted on the left.Cont,Control.4378Endocrinology,September 2006,147(9):4374–4383Odet et al.•Serine Proteinases,Serpins,and Mouse Testisarations were mimicked by bu 2cAMP (not shown).Primary cultures from the 3-wk-old preparations were not examined.The expression levels of kallikrein-21,SERPINA5,and SPINT2were not modified by a 2-h exposure with hCG or testosterone (not shown).However,their levels were signif-icantly (P Ͻ0.05)halved in primary cultures treated for 24or 48h with hCG (Fig.5B)or bu 2cAMP (not shown).Tes-tosterone had no effect (Fig.5B).Effects of the exogenous addition of protease inhibitors or of trypsinWe explored the hypothesis that the enhancement of uPA and StAR may be interdependent events.For this purpose,we carefully examined the kinetics of the hCG-induced stim-ulatory effects during the first hours of treatment to deter-mine which of uPA or StAR was first induced by hCG.Our data show that the hCG-induced enhancement of StAR and uPA followed closely the same pattern of expression up to 4h of stimulation,after which uPA levels decreased,whereas StAR levels were maintained at a significantly higher level than in the controls,in mLTC-1cells (Fig.6A).We also examined SERPINB2expression levels in the hCG-stimu-lated mLTC-1cells.We observed the appearance of a PCR product in the hCG-treated mLTC-1cells,whereas no PCR product was detected in untreated cells.However,the signal was too weak to be quantified (not shown).The expression levels of StAR were also significantly increased in primary cultures after a 2-h treatment with hCG (Fig.6B).We then explored whether the hCG-induced early peak of StAR could be mimicked by the addition of serine proteases.If so,the addition of serine protease inhibitors would de-crease the hCG-induced increase of StAR.Cells were there-fore pretreated with protease inhibitors or trypsin and then exposed to hCG for 2h and the expression of StAR was examined.The addition of serine protease inhibitors (in both normal and tumor cells)or trypsin 1,100,or 1000ng/ml (performed in the mLTC-1cells)had no effect on the hCG-or bu 2cAMP-induced StAR (Fig.6,B and C).Higher doses of trypsin resulted in cell detachment,and thus,their effect on StAR could not be examined (not shown).DiscussionIn the present study,we demonstrate that the mouse testis is the source of several serine proteinases and inhibitorsandF IG .4.Effects of hCG and bu 2cAMP on the expression levels of matriptase-2,kallikrein-21,SERPINA5,and SPINT2assessed by RT-PCR in mLTC-1cells.A,mLTC-1cells were stimulated for 2,8,or 24h with hCG 100ng/ml or bu 2cAMP 1m M .C,Control cells,i.e.untreated cells.Representative autoradiographs are shown.mLTC-1cells were cultured with (B)(ϩhCG)or without (C)hCG 100ng/ml for 16h.Cells were washed and fresh hCG-free medium was added for 24h.In A and B,autoradiographs were scanned and the expression was normalized to the HPRT signal (the same as in Fig.3for A).Values are the mean ϮSEM of n ϭ3.*,P Ͻ0.05,compared with untreated dishes in A and the time-matched controls in B.C,Western blot analysis of culture media of mLTC-1cells cultured for 24h with or without (C)100ng/ml hCG or bu 2cAMP 1m M (same culture media as in Fig.3C).Thirty micrograms of proteins were loaded per lane.Seminal vesicles (SV)and testis from adult mice (testis)were used as a positive control.The arrow points to the 46-kDa migrating band corresponding to SERPINA5.A representative gel of the three experiments performed is presented.Odet et al.•Serine Proteinases,Serpins,and Mouse Testis Endocrinology,September 2006,147(9):4374–43834379。