真菌检测鉴定通用引物Fung精编Primer精编

真菌检测鉴定通用引物F u n g精编P r i m e r精编Document number：WTT-LKK-GBB-08921-EIGG-22986ITS1: 5’-CCGTAGGTGAACCTGCGG-3’ITS4:5’-TCCTCCGCTTATTGATATGC-3’Tm 55℃NS17: CATGTCTAAGTTTAAGCAANS3: GCAAGTCTGGTGCCAGCAGCCNS4: CTTCCGTCAATTCCTTTAAGNS22: AATTAAGCAGACAAATCACTNS24: AAACCTTgTTACgACTTTTALR0R: 5’-GTACCCGCTGAACTTAAGC-3’LR3: 5’-CCGTGTTTCAAGACGGGLR3R: 5’-GTCTTGAAACACGGACC (complementary to RLR3R: GGTCCGTGTTTCAAGAC)LR5: 5’-TTAAAAAGCTCGTAGTTGAAC-3’LR7: 5’-TACTACCACCAAGATCTLR12: 5’-GACTTAGAGGCGTTCAGLr0R/LR5: Tm 50-52℃NL1: 5’-GCATATCAATAAGCGGAGGAAAAGNL1: 5′-TGCGTTGATTACGTCCCTGC (also called V9: TGCGTTGATTACGTCCCTGC)NL1: 5’-TGCTGGAGCCATGGATC-3NL2: 5’-CTCTCTTTTCAAAGTTCTTTTCATCTNL2: 5’-AACGGCTTCGACAACAGC-3NL2: 5’-CTTGTTCGCTATCGGTCTC (also NL2A: 5′-CTTGTTCGCTATCGGTCTC)NL2: 5’-TACTTGTTCGCTATCGGTCT-3'NL3: 5’-GAGACCGATAGCGAACAAG (also NL3A: 5’-GAGACCGATAGCGAACAAG)NL3: 5’-AGACCGATAGCGAACAAGTANL3: 5’-GCTGTTGTCGAAGCCGTT-3NL4: 5’（similar to RLR3R：5′-GGTCCGTGTTTCAAGAC)NL4: 5’-TAGATACATGGCGCAGTC-3Conserved primer sequences for PCR amplification and sequencing from nuclear ribosomal RNA ( lab, Duke UniversityOver the years, our lab has compiled a useful list of conserved primer sequences useful for amplification and sequencing of nuclear rDNA from most major groups of fungi (primarily Eumycota), as well as other eukaryotes. All of these primers were identified and tested by our own lab based on consensus between the published large and small subunit RNA sequences from fungi, plants and other eukaryotes; sources of other useful primer sequences from published literature are also indicated. Together, these primers span most of the nuclear rDNA coding region (see figures), permitting amplification of any desired region. Standard symbols are used for thefour primary nucleotides; variable positions are indicated as follows: P=A,G / Q=C,T / R=A,T / V=A,C /W=G,T. Primers ending with "R" represent the coding strand (same as RNA). All other primers are complementary to the coding strand. This information is provided freely and may be passed on to anyone who wants to use it.The nuclear-encoded ribosomal RNA genes (rDNA) of fungi exist as a multiple-copy gene family comprised of highly similar DNA sequences (typically from 8-12 kb each) arranged in a head-to-toe manner. Each repeat unit has coding regions for one major transcript (containing the primary rRNAs for a single ribosome), punctuated by one or more intergenic spacer (IGS) regions. In some groups (mostly basidiomcyetes and some ascomycetous yeasts), each repeat also has a separately transcribed coding region for 5S RNA whose position and direction of transcription may vay among groups. Several restriction sites for EcoRI and BglII are conserved in the rDNA of fungi. Nearly all basidiomycetes we've studied share an EcoRI site within the RNA gene along with a BglII site halfway into the LSU RNA sequence. Primers and LR7include these restriction sites, which makes them convenient for cloning.For those who aren't familiar with rDNA and fungal systematics, several excellent reviews are available on fungi (Hibbett, 1992) and generally for eukaryotes (Hillis and Dixon, 1991). See Gerbi (1986) for a general introduction to the molecular biology and evolution of rDNA in other eukaryotes. Another useful source of primer information may be found in Gargas & Depriest (1996) and at the Tom Bruns lab web siteSmall subunit RNA (SR) primers:PrimernameSequence (5'-->3')Position within S.cereviseae 17S RNA BMB-'A'GRATTACCGCGGCWGCTG580-558BMB-'B'CCGTCAATTCVTTTPAGTTT 1146-1127BMB-'C'ACGGGCGGTGTGTPC1638-1624BMB-BR CTTAAAGGAATTGACGGAA1130-1148BMB-CR GTACACACCGCCCGTCG1624-1640SR1R TACCTGGTTGATQCTGCCAGT1-21BMB = "universal" SSU primers developed by Lane et al., 1985 SR = primers developed by Vilgalys lab NS = primers described by White et al., 1990Large subunit RNA (25-28S) primer sequencesNote: most molecular systematics studies only utilizethe first 600-900 bases from the LSU gene, which includes three divergent domains (D1, D2, D3) that are among the most variable regions within the entire gene (much of the LSU is invariant even across widely divergent taxa). Most of the data in our Agaricales LSU database consists of the first 900 bases from the LSU gene (we typically amplify using primers + LR7, followed by sequencing using primers LR5, LR16, LR0R, and LR3R).Primer name Sequence (5'-->3')Positionwithin S.cereviseaerRNAcommentsCGCTGCGTTCTTCATCG51-35 RNA)containsEcoRIsite TCGATGAAGAACGCAGCG34-51 RNA)containsEcoRIsiteLR0R ACCCGCTGAACTTAAGC26-42 LR1GGTTGGTTTCTTTTCCT73-57 LR2TTTTCAAAGTTCTTTTC385-370 LR2R AAGAACTTTGAAAAGAG374-389Internal transcribed spacer (ITS) region primersThe ITS region is now perhaps the most widely sequenced DNA region in fungi. It has typically been most useful for molecular systematics at the species level, and even within species ., to identify geographic races). Because of its higher degree of variation than other genic regions of rDNA (SSU and LSU), variation amongindividual rDNA repeats can sometimes be observed within both the ITS and IGS regions. In addition to the standard ITS1+ITS4 primers used by most labs, everal taxon-specific primers have been described that allow selective amplification of fungal sequences ., see Gardes & Bruns 1993 paper describing amplification of basidiomycete ITS sequences from mycorrhiza samples).primernamesequence (5'->3')comments referenceITS1TCCGTAGGTGAACCTGCGG White etal, 1990ITS2GCTGCGTTCTTCATCGATGC (is similarto below)White et al, 1990ITS3GCATCGATGAAGAACGCAGC (is similar White etto below)al, 1990 ITS4TCCTCCGCTTATTGATATGC White etal, 1990 ITS5GGAAGTAAAAGTCGTAACAAGG (is similarto SR6R)White etal, 1990 ITS1-F CTTGGTCATTTAGAGGAAGTAA Gardes &Bruns, 1993 ITS4-B CAGGAGACTTGTACACGGTCCAG Gardes &Bruns, 1993 CGCTGCGTTCTTCATCG VilgalyslabTCGATGAAGAACGCAGCG VilgalyslabSR6R AAGWAAAAGTCGTAACAAGG Vilgalyslab Intergenic spacer (IGS) primers (including 5S RNA primer sequences for basidiomycete fungi)The greatest amount sequence variation in rDNA exists within the IGS region (sometimes also known as the non-transcribed spacer or NTS region). The size of the IGS region may vary from 2 kb upwards. It is not unusual to find hypervariability for this region (necessitating cloning of individual repeat haplotypes). Severalpatterns of organization can be found in different groups of fungi:1.Most filamentous ascomycetes have a singleuninterrupted IGS region (between the end of the LSU and start of the next SSU sequence), which may vary in length from 2-5 kb or more. Amplification of the entire IGS region requires using primers anchored in the 3' end of the LSU gene ., LR12R) and 5' end ofthe SSU RNA gene ., invSR1R).2.In many ascomycetous yeasts and nearly allbasidiomycetes, the IGS also contains a singlecoding region for the 5S RNA gene, which divides the IGS into two smaller regions that may be more easily amplified using. Depending on the orientation andposition of the 5S RNA gene, the PCR may be used to sequentially amplify either aportion of theintergenic spacer region (IGS) beyond the largesubunit RNA coding region.REFERENCESBruns, T. D., R. Vilgalys, S. M. Barns, D. Gonzalez, D. S. Hibbett, D. J. Lane, L. Simon, S. Stickel, T. M. Szaro, W. G. Weisburg, and M. L. Sogin. 1992. Evolutionary relationships within the fungi: analyses of nuclear small subunit rRNA sequences. Molec. Phylog. Evol. 1: 231-241.Bruns, T. D., T. J. White, and J. W. Taylor. 1991. Fungal molecular systematics. Ann. Rev. Ecol. Syst. 22: 525-564.DePriest, P. T., and M. D. Been. 1992. Numerous group I introns with variable distributions in the ribosomal DNA of a lichen fungus. J. Mol. Biol. 228: 315-321. Elwood, H. J., G. J. Olsen, and M. L. Sogin. 1985. The small subunit ribosomal RNA gene sequences from the hypotrichous ciliates Oxytricha nova and Stylonychia pustula. Mol. Biol. Evol. 2: 399-410.Gardes, M., and T. D. Bruns. 1993. ITS primers with enhanced specificity for basidiomycetes - application to the identification of mycorrhizae and rusts. Mol. Ecol. 2: 113-118.Gargas, A., and . DePriest. 1996. A nomenclature for fungal PCR primers with examples from intron-containing SSU rDNA. Mycologia 88: 745-748Gargas, A., and . Taylor. 1992. Polymerase chainreaction (PCR) primers for amplifying and sequencing 18S rDNA from lichenized fungi. Mycologia 84: 589-592. Gerbi, S. A. 1986. Chapter 7 - Evolution of ribosomal DNA. Pp. 419-517 In: Molecular evolution, ed. McIntyre, R.Hibbett, D. S. 1991. Phylogenetic relationships of the Basidiomycete genus Lentinus: evidence from ribosomal RNA and morphology. . Thesis, Duke University, 1991. Hibbett, D. S. 1992. Ribosomal RNA and fungal systematics. Trans. Mycol. Soc. Jpn. 33: 533-556. Hibbett, D. S., and R. Vilgalys. 1991. Evolutionary relationships of Lentinus to the Polyporaceae: evidence from restriction analysis of enzymatically amplified ribosomal DNA. Mycologia 83: 425-439.Hibbett, D. S., and R. Vilgalys. 1993. Phylogenetic relationships of the Basidiomycete genus Lentinusinferred from molecular and morphological characters. Syst. Bot. 18: 409-433.Hillis, D. M., and M. T. Dixon. 1991. Ribosomal DNA: molecular evoluiton and phylogenetic inference. Quart. Rev. Biol. 66: 411-453.Hopple, J. S., Jr., and R. Vilgalys. 1994. Phylogenetic relationship among coprinoid taxa and allies based ondata from restriction site mapping of nuclear rDNA. Mycologia 86: 96-107.Lane, D. J., B. Pace, G. J. Olsen, D. A. Stahl, M. L. Sogin, and N. R. Pace. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. Proc. Natl. Acad. Sci., U. S. A. 82: 6955-6959.Vilgalys, R., and D. Gonzalez. 1990. Organization of ribosomal DNA in the basidiomycete Thanatephorus praticola. Curr. Genet. 18: 277-280.Vilgalys, R., J. S. Hopple, Jr., and D. S. Hibbett. 1994. Phylogenetic implications of generic concepts in fungal taxonomy: The impact of molecular systematic studies. Mycologica Helvetica 6: 73-91.White, T. J., T. Bruns, S. Lee, and J. W. Taylor. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pp. 315-322 In: PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., NewYork.W°。