短期镉或汞诱导金属硫蛋白在mRNA和蛋白响应上的差异

Aquatic Toxicology 97 (2010) 260–267
Contents lists available at ScienceDirect
Aquatic
Toxicology
j o u r n a l h o m e p a g e :w w w.e l s e v i e r.c o m /l o c a t e /a q u a t o
x
Short-term metallothionein inductions in the edible cockle Cerastoderma edule after cadmium or mercury exposure:Discrepancy between mRNA and protein responses
Ika Paul-Pont ∗,Patrice Gonzalez,Magalie Baudrimont,Hanane Nili,Xavier de Montaudouin
UniversitéBordeaux 1–CNRS,UMR 5805EPOC,CNRS,Station Marine d’Arcachon,Place du Dr.Peyneau,Arcachon 33120,France
a r t i c l e i n f o Article history:
Received 17September 2009Received in revised form 26November 2009
Accepted 5December 2009Keywords:
Cerastoderma edule Metallothionein Gills
Cadmium Mercury
mRNA Expression
a b s t r a c t
Metallothioneins (MT)are essential metal binding proteins involved in metal homeostasis and detoxifica-tion in living organisms.Numerous studies have focused on MT response to metal exposure and showed an important variability according to species,metal,concentration and time of exposure.In this study,the expression of one isoform of MT gene (Cemt1)and associated MT protein synthesis were determined after 1,3,9,24,72and 168h of cadmium (Cd)or mercury (Hg)exposures in gills of the cockle Cerasto-derma edule .This experiment,carried out in laboratory conditions,revealed that in Cd-exposed cockles,induction of Cemt1is time-dependent following a “pulse-scheme”with significant upregulation at 24h and 168h intersected by time point (72h)with significant downregulation.MT protein concentration increases with time in gills of exposed cockles in relation with the progressive accumulation of Cd in soluble fraction.On contrary,Hg exposure does not lead to any induction of Cemt1mRNA expression or MT protein synthesis compared to control,despite a higher accumulation of this metal in gills of cockles compared to Cd.The localization of Hg (85–90%)is in insoluble fraction,whereas MT was located in the cytoplasm of cells.This gives us a first clue to understand the inability of Hg to activate MT synthesis.However,other biochemical processes probably occur in gills of le since the remaining soluble frac-tion of Hg exceeds MT sequestration ability.Finally,since one of the first main targets of metal toxicity in cells was the mitochondria,some genes involved in mitochondria metabolism were also analyzed in order to assess potential differences in cellular damages between two metal exposures.Indeed,until T 168,no impact on mitochondrial genes was shown following Hg exposure,despite the complete lack of MT response.This result indicated the presence of other effective cellular ligands which sequester the cytosolic fraction of this metal and consequently inhibit metal reactivity.Such competition mechanisms with other cytosolic ligands more sensitive to Hg were particularly argued in the discussion.
© 2009 Elsevier B.V. All rights reserved.
1.Introduction
Metallothioneins (MTs)are low molecular mass cysteine-rich metal-binding proteins found in a large variety of organisms.MTs have been suggested to play an important role in zinc and copper homeostasis,detoxification of non-essential trace elements such as cadmium (Cd)and mercury (Hg)(Langston et al.,1998)and in the protection against oxidative stress by intracellular scavenging of free radicals (Andrews,2000).Due to its highly inducible expression during exposure to various trace metals,MTs have been given much
∗Corresponding author.Tel.:+33556223930;fax:+33556549383.E-mail addresses:i.paulpont@epoc.u-bordeaux1.fr (I.Paul-Pont),p.gonzalez@epoc.u-bordeaux1.fr (P.Gonzalez),
m.baudrimont@epoc.u-bordeaux1.fr (M.Baudrimont),h.nili@etu.u-bordeaux1.fr (H.Nili),x.de-montaudouin@epoc.u-bordeaux1.fr (X.de Montaudouin).attention as a potential molecular bioindicator to monitor metal pollution of aquatic environment,a major recipient of pollutants.However,a variety of factors can induce its expression in tissues (hormones,physical and physiological stress,inflammation pro-cesses,etc.)leading to the difficulty to interpret MT variation in the field correctly.Therefore,MTs are now considered as a stress indica-tor in organisms,but most studies concern the primary relationship between metal accumulation and MT expression (for review see Amiard et al.,2006;Coyle et al.,2002).
The edible cockle Cerastoderma edule is an infaunal suspension feeder previously used as a bioindicator of metal pollution because it accumulates large amount of environmental pollutants due to its high filtering activity related to nutritional and respiratory needs (Cheggour et al.,2001).Indeed,such molluscs exhibit great spatial sensitivity to pollutants and are the most reliable tool to detect biologically available heavy metals exposure in environment.With regards to overall toxic effects of heavy metals to bivalve
0166-445X/$–see front matter © 2009 Elsevier B.V. All rights reserved.doi:10.1016/j.aquatox.2009.12.007
本页已使用福昕阅读器进行编辑。

福昕软件（Ｃ）２００５－２０１０，版权所有，仅供试用。

I.Paul-Pont et al./Aquatic Toxicology 97 (2010) 260–267261
molluscs,studies on mechanisms of metal accumulation,associ-ated with detoxification processes such as MT induction would contribute to better understanding of physiological response to cellular stress and adaptation in presence of
elevated metal bioavailability.Indeed,metal bioavailability,but not metal concen-tration,can often increase as a function of natural phenomenon,leading to a difficulty in evaluating MT responses in terms of biomarker in field conditions.
The complete amino acid sequence of one isoform of MT (Cemt1)has been determined in the cockle le and a preliminary study showed an important induction of Cemt1expression and associated MT protein synthesis after 2and 10days of Cd-exposure in le whereas no induction both at gene and protein levels was shown after Hg exposure (Paul-Pont et al.,under review ).The lack of MT response after Hg-exposure in the cockle was particularly interest-ing in regard to the strongest accumulation of Hg compared to other metals and to other bivalve species (Baudrimont et al.,2005).The present work aims to (i)understand the apparent differences in MT gene and protein responses between Cd and Hg,known as power-ful inducers of MT and (ii)assess potential differences in cellular damages between both metal exposures by the analyze of some mitochondrial genes.Indeed,numerous studies have shown that one of the main targets of cellular metal toxicity were mitochon-dria (Cambier et al.,2009;de Oliveira Ribeiro et al.,2008).Since MT protein synthesis differs strongly between exposure to the two metals,cell protection against metal toxicity may also be very dif-ferent.Particularly,in the context of Hg exposure,the lack of MT response may lead to several impacts in mitochondria metabolism and integrity,except if other efficient detoxification mechanisms sure at particularly early kinetic points (1,3,9,24,72and 168h).Indeed,most studies working on MT response in cockles have been realized only after 7or 14days of metal exposure without taking into account potential earlier responses of MT (Baudrimont and De Montaudouin,2007;Desclaux-Marchand et al.,2007).However,among physiological processes involved in response to metal expo-sure,molecular response and transcriptional gene regulation set up precociously from the first hours and occurred upstream from other biochemical pathways like protein synthesis.Finally,by studying one gene allowing us to quantify number of mitochondria in cells (12S ),another involved in mitochondrial electron transfer chain (coxI ),and a last one implied in oxidative stress response (sod ),we could assess potential damages of Cd and/or Hg on the mitochon-dria integrity and metabolism.Indeed,metals such as Cd or Hg can severely affect mitochondrial integrity and metabolism by inhibit-ing the mitochondrial electron transfer chain and inducing reactive oxygen species (ROS)production (Wang et al.,2004).
2.Materials and methods
2.1.Sampling site and bivalve exposure
Cockles were collected in January 2009at Banc d’Arguin,a moderately sheltered sand flat,in Arcachon Bay (France,44◦40 N 1◦10 W).This site was selected because of the lack of heavy metal exposure and therefore it gives the possibility to obtain uncontam-inated control specimens (Baudrimont et al.,2006).Indeed,Banc
d’Arguin is a National Natural Reserve with a large part dedicated to oyster farming and tourism.However,this nature reserve also includes a large prohibited area where there is strictly no activity except scientific sampling.Our cockles were coming from this area,free of human disturbance.The only identified stressor is digenean parasites but we checked that our individuals were free of the most deleterious species (Bucephalus minimus ).
Cockles were maintained in laboratory for 3days prior to experiments;this relatively short delay was chosen because we considered that the stress that was undergone by cockles was minimized due to the utilisation of the same water as in the field (with sediment)at similar field temperature.Cockles were fed with a concentrated diatom culture (Thalassiosira weissflogii )(≈105algae ml −1per experimental unit)every two days during both acclimatization and exposure periods in experimental units (EU).The culture of diatoms was carried out at the laboratory under controlled conditions allowing us to obtain an axenic cul-ture without trace metal exposure.The experiment was conducted in laboratory using glass aquaria of 25cm ×25cm ×30cm filled with 10L of sea water sampled at Banc d’Arguin (salinity =30psu)aerated by a diffuser system.A 3-cm layer of ultra pure sand allowed the cockles to bury.Plastic coverings (polyethylene)were placed over inside walls to avoid metal contamination and to min-imize metal adsorption on walls.The temperature was fixed at 15.0◦C (±0.2◦C),pH was regularly monitored and remained sta-ble (8.0±0.1)and the photoperiod was fixed at 12h using a timer and artificial light sources.Five EU were used for each exposure condition with 16cockles (31–35mm length)per EU.At T 0the three following conditions were applied to EU:control condition without metals,mercury (Hg)exposure at 7.5nM (corresponding to 1.5␮g Hg L −1added as HgCl 2)and cadmium (Cd)exposure,with a nominal concentration of 44nM (corresponding to 5␮g Cd L −1added as CdCl 2).Metal quantification in water of experimental units was performed every day to ensure that metal concentra-tion remained constant throughout the experiment period.Any decrease of metal concentration due to adsorption and absorp-tion mechanisms was daily compensated for by addition of metal solution.Finally,the metal concentrations used in this laboratory experiment were pertinent in terms of environmental relevance since same range of concentrations have been recorded in severely impacted rivers or estuaries (Audry et al.,2004;Feng,2005;Ferrara et al.,1998;Mohamed et al.,1998;Nascimento et al.,2006).In addi-tion,the Hg concentration was also chosen in relation with previous studies conducted on cockles le in order to assess the potential toxicity of Hg contents found in cockles from the Gironde estuary (Baudrimont et al.,2005).2.2.Sampling procedure
At each sampling time,T 0=0h,T 1=1h,T 3=3h,T 9=9h,T 24=24h,T 72=72h and T 168=168h =7days,two cockles were taken from every experimental unit leading to n =10individu-als per exposure treatment at one time.As soon as cockles were removed,gills were separated from visceral mass and remaining tissues (including muscles,mantle and foot tissues).Foot and man-tle of cockles were squeezed between two sterilized glass slides and observed under a stereomicroscope in order to verify the absence of parasites and particularly the macroparasite Bucephalus minimus as these parasites have strong negative impacts on host physiology.Gills from two individuals were pooled and homogenized.There-fore,five replicates of two homogenized individuals were treated for analyses.Gills were chosen for this study instead of digestive gland because this organ represents the first barrier involved in dis-solved metal uptake via the direct exposure route,due to its large exchange area in direct contact with the surrounding environment.Since we aim to observe response of metallothionein to dissolved
本页已使用福昕阅读器进行编辑。

福昕软件（Ｃ）２００５－２０１０，版权所有，
仅供试用。

262I.Paul-Pont et al./Aquatic Toxicology97 (2010) 260–267
metal exposures in a very short time course(four of the six kinetic points were taken for analysis during thefirst24h),it seems more appropriate to focus on gills as a target tissue for short term dis-solved metal exposure and MT synthesis than the digestive gland which reflects a more long term metal exposure.
A minimum of50mg of gills was dissected for metallothionein quantification and were kept into polyethylene bags(Whirl-Pak) under N2atmosphere at−80◦C in order to minimize metalloth-ionein oxidation until the analysis.Gills(20–40mg)were put in 500␮L of RNA later(Qiagen)and kept at−80◦C until genetic analyses.The rest of gills was divided for total and subcellular (soluble/insoluble fractions)metal determination.
2.3.Metallothionein quantification
The concentration of total MT protein was determined in gills by the mercury-saturation assay,using cold inorganic mercury (Baudrimont et al.,2003;Dutton et al.,1993).Metallothionein analysis was conducted on5replicates per exposure condition, the saturation assay being repeated twice per sample.This tech-nique is based on the quantification of Hg bound to the saturated MT.The denaturation of non-MT proteins was performed using trichloroacetic acid and the excess Hg not bound to the MT was removed by scavenging with lyophilized beef hemoglobin(Sigma) prepared in30mM Tris–HCl buffer(pH8.2at20◦C).Thefinal supernatant,containing the metallothionein fraction,was then quantitatively recovered and used for Hg determination byflame-less atomic absorption spectrometry(AMA254,Altec,Prague, Czech Republic).The detection limit was estimated at0.01ng Hg. The exact quantity of Hg binding sites per MT molecule being unknown for this species,MT levels was expressed in nmol Hg binding sites g−1(wet weight).The measure of MT concentration in relation to specific tissue weight allowed us to directly compare MT concentration with bioaccumulation results expressed in relation to tissue weight,too.Moreover,this calculation method in relation with tissue weight is classically used in the metal saturation tech-nique and allowed us to compare our results with numerous data available in the literature(Campbell et al.,2005;Couillard et al., 1993;Perceval et al.,2006).
At the same time,three reference samples or“blanks”were pre-pared to monitor the Hg complexation efficiency of the hemoglobin. The mean of the three blank values at each analytical run was deducted from the Hg burdens measured in each sample.
A recovery percentage from purified rabbit liver MT(Alexis biochemicals ALX-202-071)was systematically determined.This “internal standard”enabled us to determine the ratio between the binding sites measured after Hg saturation and the potential bind-ing sites indicated by the supplier and previously verified by Cd and Zn determinations on purified MT solution samples.Through-out our metallothionein analyses,the mean recovery percentage was92.7±5.6%.This value was consistently within the certified ranges(100±20%)of the method.
2.4.Metal quantification and cellular fractionation
Metal quantification was carried out for the water in the EU and the gills of cockles.For metal determination in EUs,water samples were acidified at2%HNO3before analyses.Gills of cockles were separated on two aliquots for total metal quantification and for cellular fractionation.
For total metal quantification in gills of cockles,tissues were digested in1–1.5mL(depending on weight of tissue)of nitric acid (Fluka;Buchs,Switzerland.65%HNO3)at100◦C under for3h in a drying oven in order to dissolve metals in the liquid for quantifi-cation.After a sixfold dilution of digestates with ultrapure water (MilliQ®,Bedford,MA,USA)Hg and Cd concentrations were ana-lyzed.Cd concentration was determined by electrothermic atomic absorption Spectrophotometry with Zeeman correction,using a graphite furnace(M6Solar AA spectrometer,Thermoptec).The detection limit was0.1␮g Cd L−1.Total Hg concentrations were determined byflameless atomic absorption spectrometry.Analy-ses were carried out automatically after thermal decomposition at 750◦C under an oxygenflow(AMA254,Prague,Czech Republic). The detection limit was0.01ng Hg.
Metal repartition in gills was only determined at T24,T72and T168,corresponding to times from which accumulation of both met-als in exposures was significantly different from control.In order to determine metal concentration and repartition in soluble and insol-uble fractions,gills were homogenized in1mL of25mM Tris–HCl buffer(pH7.2at20◦C)with an electric crusher(Ultra-Turrax T-25).The homogenate was centrifuged at4◦C and20,000×g during 60min.The supernatant was recovered and acidified at2%for metal quantification in soluble fraction.The remaining pellet was digested in1.5mL of nitric acid(Fluka;Buchs,Switzerland,65% HNO3)at100◦C for3h in a drying oven in order to determine metal concentration in insoluble fraction.Metal concentrations in both fractions(supernatant and pellet)were analyzed as described above.
The analytical methods of cadmium and mercury quantifica-tion were simultaneously validated for each sample series by the analysis of standard biological reference materials(Tort-2:Lobster hepatopancreas and Dolt-3:Dogfish liver from National Research Council of Canada,Ottawa).Throughout our cadmium analyses, mean values(n=60)of Tort-2and Dolt-3were27.2±0.5␮g/g and19.2±0.7␮g/g,respectively.Throughout mercury analyses, mean values(n=60)of Tort-2and Dolt-3were27.1±0.3␮g/g and 19.9±0.2␮g/g,respectively.These values were consistently in cer-tified ranges of Tort-2and Dolt-3.
2.5.Total RNA extraction and reverse transcription of RNAs
Total RNA was extracted from20to40mg of tissue using the “Absolutely RNA Miniprep kit”(Agilent),according to the manufac-turer’s instructions.The concentration of all RNAs was determined by spectrophotometry at260nm.First-strand cDNA was synthe-sized from5␮g of total RNA using the Stratascript First-Strand Synthesis System(Agilent)according to the manufacturer’s instruc-tions.The cDNA mixture was conserved at−20◦C until using it in
a real-time PCR reaction.
2.6.Real-time quantitative PCR
The amplification of cDNA was monitored using the DNA inter-calating dye SybrGreen I.Real-time PCR reactions were performed in a Light Cycler(Roche)following the manufacturer’s instruc-tions.The amplification program consisted of one cycle at95◦C for 10min and50amplification cycles at95◦C for5s,60◦C for5s,and 72◦C for20s.Each20␮L reaction contained1␮L of cDNA,17␮L of master mix including the SybrGreen Ifluorescent dye(Roche), enabling the monitoring of the PCR amplification,and2␮L of the gene specific primer pair at afinal concentration of300nM for each primer.Primer pairs used to quantify mRNAs of genes of inter-est are listed in Table1.Reaction specificity was determined for each reaction from the dissociation curve of the PCR product.This dissociation curve was obtained by following the SybrGreenfluo-rescence level during a gradual heating of the PCR products from 60to95◦C.Relative quantification of each mRNA expression level of a gene was normalized according to a mRNA expression of a housekeeping gene,the␤-actin.Relative mRNA expression of a gene was generated using the2− CT method as described by Livak and Schmittgen(2001)and CT represents the difference between the cycle threshold(cycle at which thefluorescence from a sample
本页已使用福昕阅读器进行编辑。

福昕软件（Ｃ）２００５－２０１０，版权所有，
仅供试用。

I.Paul-Pont et al./Aquatic Toxicology97 (2010) 260–267263
Table1
Nucleotide sequences of specific primer pairs used in this study.
Gene Function Sequence5 –3
ˇ-actin Cytoskeletal gene(house keeping gene)CTGTTGTATGTGGTCTCATGGAT b
GCTACGTTGCCCTTGACT a
coxI Sub unit1of the cytochrome C oxidase(complex4of the mitochondrial respiratory channel)CTCGCTAATACGACTCCAGTCA b
GGTCGGCTTGGACGTAGA a
12S Small subunit12S of the ribosomal RNA AATACGGAAGTGTTGGGCG a
AGAAGAATGGCGAAGCTCTTT b
sod Mitochondrial superoxide dismutase(Mn)GGCGTGCTCCCAGACATC b
CAGGGATCAGGATGGGG a
Cemt1Metallothionein gene(isoform1)CGATGTGGATCAGGCTGTGGG a
CGACAGATACTCCCACCGAC b Abbreviations:a:upstream primer and b:forward primer.
crosses the threshold)of specific gene and the cycle threshold of
the␤-actin.Therefore,the mRNA induction factor(IF)of each gene
in comparison with control corresponds to the following equation:
IF=2− CT(Treatment) 2− CT(control)
2.7.Statistical analyses
The effect of time and metal exposure(independent variables) on metal accumulation and MT protein expression(dependent variables)was tested using a crossed two-way ANOVA.Prior to analysis,normality was assumed,homogeneity of variance was checked and data were log(x+1)transformed when necessary. Whenever ANOVA was significant,differences between treatments were separated by Tukey means comparison test.In the real-time quantitative PCR,for each mRNA expression level,the mean value and the associated standard deviation(n=5)were determined. The mean values for each exposure level were statistically com-pared to those of the control condition using the non-parametric Mann–Whitney U-test.From this comparison,induction factors of specific gene were obtained by comparing each mean value observed in the exposed bivalves with that of the control ones. Analyses were performed using Statistica7.1software for Win-dows.
3.Results
3.1.Cd and Hg bioaccumulation
Cd and Hg concentrations remained low and constant in gills of control bivalves(660±59and428±50ng g−1(dw),mean±SE, respectively)throughout the experiment(Figs.1and2).In exposed cockles,Cd concentration increased significantly with time(p<0.0001)(Fig.1).Cadmium accumulation,not relevant during thefirst twelve hours,became statistically significant from T24(value of Tukey means comparison test,p=0.0180)and reached12,436±3160ng g−1dw(mean±SE),in gills of cock-les at T168(Fig.1).In Hg-exposed cockles,bioaccumulation was statistically significant from thefirst hour(T1)(value of Tukey means comparison test,p=0.0421)and Hg concentration in gills of cockles increased significantly with time(p<0.0001)up to 19,127±2508ng g−1dw(mean±SE)at T168(Fig.2).Moreover,Hg concentrations were significantly higher than Cd concentrations in gills of exposed cockles(p<0.0001)throughout the experiment, although concentration of Cd in water was3.3-fold higher than those of Hg.3.2.Cellular repartition of metals
Metal repartition in gills of cockles was analyzed at T24,T72 and T168corresponding to times from which accumulation of both metals was significantly higher in exposed than in control ani-mals(Figs.1and2).Metal repartition in soluble and insoluble fractions was formulated as a percentage of total metal content in whole gills of cockles(Table2
).Metal repartition differed sig-nificantly as a function of the nature of metal(p=0.0211)both in control and exposed cockles.While Cd was equally found in solu-ble and insoluble fraction,Hg was located especially in insoluble fraction(85–90%).Repartition of
Cd differed between control and exposed bivalves since67–74%of Cd was found in soluble fraction of gills from control bivalves,whereas this percentage decreased
Fig.1.Concentration of cadmium in gills of control(····)and exposed(—)cockles in function of time(mean±SE,n=5).The same letter in bold(a,b,c,d)indicates similar values(p>0.05).
Fig.2.Concentration of mercury in gills of control(····)and exposed(—)cockles in function of time(mean±SE,n=5).The same letter in bold(a,b,c,d)indicates similar values(p>0.05).
264I.Paul-Pont et al./Aquatic Toxicology 97 (2010) 260–267
Table 2
Metal repartition in soluble (supernatant)and insoluble (pellet)fractions expressed as a percentage (mean ±SE,n =5)of total metal content in whole gills of control and contaminated cockles after 24h,72h and 168h of metal exposure.
Control Contaminated Supernatant
Pellet Supernatant Pellet Cd T 2466.8±2.633.2±2.653.0±3.246.9±3.2T 7274.3±1.525.7±1.549.6±6.950.4±6.9T 16873.6±1.226.4±1.248.5±4.551.5±4.5Hg T 2412.1±2.687.9±2.613.9±1.386.1±1.3T 729.3±1.490.7±1.415.4±3.184.6±3.1T 168
8.3±0.9
91.7±0.9
9.7±0.8
90.4±0.8
to 49–53%in soluble fraction of Cd-exposed bivalves.On the con-trary,repartition of Hg between soluble and insoluble fractions was equivalent between control and exposed cockles with an average of 89%of Hg associated with insoluble fraction.3.3.Metallothionein response
No significant effect of time (p =0.1491)was shown on MT response in control cockles,MT concentrations remained low and constant in
gills of control bivalves throughout the experiment (Figs.3and 4).In Cd-exposed cockles a slight increase of MT con-centration in gills was found at T 72.However,this increase was statistically significant only after 168h of Cd exposure and
reached 16.7±5.0nmol Hg sites g −1wet weight at this time (p =0.0002)(Fig.3).In Hg-exposed cockles,MT concentration remained low and no significant difference appeared in comparison with control bivalves throughout the experiment (p =0.1523)(Fig.4).
Fig.3.Metallothionein concentrations in gills of control (····)and exposed (—)cock-les after Cd exposure (mean ±SE,n =5).The same letter in bold (a,b,c,d )indicates similar values (p >0.05).
Fig.4.Metallothionein concentrations in gills of control (····)and exposed (—)cockles after Hg exposure (mean ±SE,n =5).
Table 3
Differential gene expression observed in gills of cockles after direct contamination.Results are given as significant induction (>1)or repression (<1)factors as compared to control cockles.“/”indicates no significant variation compared to control cockles.
Cd Hg Cox1
12S Sod (Mn)Cemt1Cox112S Sod Cemt1T 14 2.5 2.5//0.20.10.3T 3///0.2///0.2T 90.20.1//////T 240.40.10.3 4.5///0.3T 72///0.4///0.4T 168
0.3
0.4
0.3
2
7
2.5
61.5
5.5
3.4.Genetic expression
The mRNA expression of a few genes involved in mitochondrial metabolism was analyzed by real-time quantitative PCR:the gene encoding subunit 1of the cytochrome C oxidase which constitutes the complex 4of the mitochondrial respiratory channel,the gene for mitochondrial rRNA 12S which gives us an idea of the num-ber of mitochondria in cells and the gene encoding mitochondrial superoxide dismutase which catalyzes the dismutation of superox-ide into hydrogen peroxide.Table 3presents only induction factors statistically different from control (p <0.05)according to the non-parametric Mann–Whitney U -test.
Cd exposure led to a significant induction of mRNAs of mito-chondrial genes such as CoxI (×4),12(×2.5)and sod (Mn)(×2.5)after 1h of metal exposure (T 1)(Table 3).From T 3to T 168,the mRNA expression of these genes was equivalent to control (T 3and T 72)or significantly down regulated (T 9,T 24and T 168).While no signifi-cant modulation of mRNAs of mitochondrial genes appeared at T 3and T 72,the mRNA of Cemt1gene was significantly down-regulated at these times.Finally,inductions of mRNA of Cemt1gene by a factor 4.5and 2were shown after 24and 168h of Cd exposure,respectively.
Pattern of mRNA expression was significantly different after Hg-exposure.Indeed,no significant variation of mitochondrial genes transcription was shown during the first 72h (Table 3)except for 12S and sod (Mn)which were down-regulated at T1.mRNA of Cemt1gene was down-regulated at T 1,T 3,T 24and T 72.At T 168,an oppo-site pattern was found since significant inductions of mitochondrial gene mRNAs (×7,×2.5,and ×61.5for CoxI ,12S and sod (Mn),respec-tively)were observed in gills of Hg-exposed bivalves in comparison to control,as well as for Cemt1gene (×5.5).4.Discussion
Marine molluscs are known to accumulate and tolerate high concentrations of metallic and organic pollutants (Kim et al.,2008).
1998;Lecoeur et al.,2004).This is supported by the literature,in which gills are represented as a short time storage organ,while in the digestive gland absorption will lead to an accumulation of toxic metals for a longer time (Amiard et al.,1989).Regarding cad-mium and mercury accumulation and elimination,Marigómez et al.(1995)concluded that those processes were associated with lyso-somes of the digestive cells.Therefore,visceral mass of bivalves may play significant role on Cd and Hg detoxification processes.However,in this study we only focused on gills because a pre-liminary study conducted on both tissues (gills and visceral mass)of cockles demonstrated similar results in terms of MT responses (mRNA and protein)after 2and 10days of Cd and Hg exposures.In addition,gills were more appropriated for the present purpose
本页已使用福昕阅读器进行编辑。

福昕软件（Ｃ）２００５－２０１０，版权所有，仅供试用。