gene-targeting

Development and re finement of a high-ef ficiency gene-targeting system for Aspergillus flavus
Perng-Kuang Chang ⁎,Leslie L.Scharfenstein,Qijian Wei,Deepak Bhatnagar
Southern Regional Research Center,Agricultural Research Service,U.S.Department of Agriculture,1100Robert E.Lee Boulevard,New Orleans,LA 70124,United States
a b s t r a c t
a r t i c l e i n f o Article history:
Received 7January 2010
Received in revised form 19February 2010Accepted 4March 2010
Available online 16March 2010Keywords:
Aspergillus flavus A flatoxin
Functional genomics pyrG
Gene targeting Conidial pigment
An ef ficient gene-targeting system based on impairment of the nonhomologous end-joining pathway and the orotidine monophosphate decarboxylase gene (pyrG )in Aspergillus flavus was established.It was achieved by replacing the ku70gene with the Aspergillus oryzae pyrithiamine resistance (ptr )gene and by inserting the Aspergillus parasiticus cypA gene into the pyrG locus.The utility of this system was demonstrated by disruption of nine candidate genes for conidial pigment biosynthesis.The gene-targeting frequencies ranged from 80to 100%.Two linked genes on chromosome 4,wA and olgA ,were con firmed to be involved in pigment formation.In contrast to the parental strain which produced yellowish-green conidia,the knockout mutants produced white and olive-green conidia,respectively.The system was further re fined by restoring the pyrithiamine sensitivity and uracil auxotrophy in the A.flavus transformation recipient with an engineered pyrG marker.The improvement allowed gene manipulation using the reusable pyrG marker as shown by the restoration of laeA -mediated a flatoxin production in an A.flavus laeA -deleted mutant.
Published by Elsevier B.V.
1.Introduction
Aspergillus flavus is a main producer of carcinogenic a flatoxins and is a pathogen of many agricultural commodities.It is also the second leading causative agent of invasive and non-invasive aspergillosis (Hedayati et al.,2007).A flatoxins,if ingested,pose a great risk to human and animal health,hence,their levels are stringently regulated (Guzman-de-Pena and Pena-Cabriales,2005;Otsuki et al.,2001).Of 77countries having regulations limiting mycotoxins,48have speci fic regulatory levels for total a flatoxins in foodstuffs and 21have regulations for a flatoxins in feedstuffs (FAO,1997).Signi ficant economic losses thus can result from a flatoxin contamination of food and feed.
The estimated A.flavus genome is 37Mb and contains about 12,000genes (Payne et al.,2006).Genomic resources such as whole genome sequence and EST of A.flavus play an increasingly important role in the understanding of a flatoxin biosynthesis and fungus –plant interactions (Payne et al.,2006;Yu et al.,2004).Equally important is their impact on the understanding of A.flavus pathogenicity in humans and animals.The functions of the majority of A.flavus genes,however,are unknown.Although DNA microarrays allow genome-wide gene expression and association to be studied (Cary et al.,2007;Wilkinson et al.,2007),gene targeting along with subsequent genetic complementation to regain lost traits is still the best approach for understanding gene function.
Historically,only Neurospora crassa orotidine monophosphate decarboxylase gene,pyr-4(Woloshuk et al.,1989),is frequently used for A.flavus transformation.A few others including A.flavus β-tubulin gene (Seip et al.,1990)and A.parasiticus nitrate reductase gene (Duran et al.,2007)are occasionally used.The ble gene for resistance to the antibiotic phleomycin has been demonstrated as a positive selectable marker for A.flavus (He et al.,2007);its ef ficacy is still under evaluation.Resistance markers developed from closely related A.oryzae ,such as the ptr pyrithiamine resistance gene (Kubodera et al.,2000)and a mutated succinate dehydrogenase gene,sdhB (cxr),resistant to carboxin,a systemic fungicide,developed for A.oryzae and A.parasiticus are likely applicable to A.flavus (Shima et al.,2009).
High-throughput gene functional analysis requires an ef ficient system to reduce time and labor involved in identifying gene knockouts.Signi ficant increases in gene-targeting frequencies have been reported by disabling components of the nonhomologous end-joining (NHEJ)pathway,such as DNA-dependent protein kinase catalytic subunits of Ku70and Ku80,and DNA ligase IV (da Silva Ferreira et al.,2006;Meyer et al.,2007;Mizutani et al.,2008;Ninomiya et al.,2004;Takahashi et al.,2006).Adopting available protocols,demonstrating their ef ficacy and establishing a useful system for A.flavus remains a daunting task.This is particularly true when a system,in terms of selectable marker and recipient strain,is required for multiple rounds of gene-targeting experiments or for reintroducing targeted genes into a knockout strain.The inadequacy of current systems in these aspects has,in part,hampered the progress of the functional genomics in A.flavus .
In this study,we first established a gene-targeting system for A.flavus by replacing ku70with A.oryzae ptr and by creating a uracil
Journal of Microbiological Methods 81(2010)240–246
⁎Corresponding author.Tel.:+15042864208;fax:+15042864419.E-mail address:perngkuang.chang@ (P.-K.
Chang).0167-7012/$–see front matter.Published by Elsevier B.V.doi:
10.1016/j.mimet.2010.03.010
Contents lists available at ScienceDirect
Journal of Microbiological Methods
j o u r na l h o m e p a g e :w w w.e l se v i e r.c o m /l o c a t e /j m i c m e t h
auxotroph using a knock-in technique(Bardiya and Shiu,2007;Skory et al.,1990).We demonstrated its utility by disrupting several candidate genes and identified two genes involved in conidial pig-ment biosynthesis.We further refined this system by restoring pyrithiamine sensitivity with an engineered pyrG marker for subse-quent re-creation of the uracil auxotrophy.The incorporation of the reusable pyrG marker to the resulting recipient strain makes this improved system facilitate functional genomics study.
2.Materials and methods
2.1.Fungal strains
The A.flavus CA14which produces aflatoxins and large sclerotia (Hua et al.,2007)was isolated from a pistachio bud in the Wolfskill Grant Experimental Farm(University of Davis,Winters,California, USA).CA14N1is a nitrate-nonutilizing strain derived from CA14.On a Difco™Czapek Solution Agar(CZ,Becton and Dickinson Company, Sparks,Maryland,USA)plate it exhibited expansive mycelial growth but barely produced conidia due to its inability to use nitrate,which is the sole nitrogen source of CZ.
2.2.Construction of A.flavus ku70disruption vector
In silico identification of the A.flavus ku70gene was performed initially on the5X draft database of the A.flavus genome sequence (http://www.aspergillusfl/genomics/).The ku70disruption vector was constructed in three steps.First,a0.5kb ku70coding region at the5′end(Fig.1A)was amplified by PCR using primers ku94H and ku600P(see Table1for all primers with designations and sequences).The PCR fragment after digestion with HindIII and PstI was cloned into the corresponding sites in pUC19.Second,a0.5kb coding region at the3′end was generated by PCR with ku1650P and ku2150K.The fragment was cloned into the vector obtained from the first step.Third,the2.0kb A.oryzae ptr marker amplified from pPTR1 (TaKarRa,Japan)with ptrU730P and ptr1230P was digested with PstI and cloned into the PstI site of the above construct.The disruption vector,pAfKuDV,was linearized by FastDigest®HindIII and KpnI in a universal buffer(Fermentas,Glen Burnie,Maryland,USA)prior to fungal transformation.Approximately5μg DNA was used in each of the two transformation experiments.
2.3.Preparation of protoplasts and transformation
In the initial transformation for the disruption of the ku70gene, approximately108conidia harvested from V8agar plates(Chang and Hua,
2007)were inoculated into100ml Czepak-Dox Broth(Becton and Dickinson)supplemented with0.5%casamino acids.The culture was shaken at150rpm for11–12h at30°C.Mycelia were collected on a 100μm nylon cell strainer,transferred to a50ml tube,and resuspended in 20ml offilter-sterilized enzyme solution that contained200mg lysing enzymes from Trichoderma harzianum(L1412,Sigma,St.Louis,Missouri, USA),50mg driselase,(Sigma),and40mg cell-wall digesting enzyme (Applied Plant Research,The Netherlands)in0.55M KC1,0.05M citric acid,pH5.8.The digestion was allowed to progress for2–3h at30°C with shaking(60rpm).Protoplasts were harvested byfiltering through a 40-μm nylon cell strainer and pelleted using a microcentrifuge.The protoplasts were washed twice with a solution of0.6M KC1,50mM CaC12and10mM Tris–HCl,pH8.0.Fungal transformation was performed as previously described with minor modifications(Horng et al.,1990). Polyethylene glycol(PEG)solution consisting of40%(w/v)PEG4000 (Fluka,Germany),0.6M KCl,50mM CaC12and10mM Tris–HC1,pH8.0 was used instead.The transformation mixture was added to CZ regeneration medium containing0.6M KCl,5mM ammonium sulfate, and0.1μg pyrithiamine(PT)/ml.Plates were incubated at30°C for up to 10days.2.4.Confirmation of gene disruption by PCR
Conidia of PT-resistant colonies were inoculated into1ml Potato Dextrose Broth(PDB;EMD Chemicals Inc.,Damstadt,Germany)in a 2-ml microfuge tube.The tube was incubated horizontally at30°C for 18to24h.Harvested mycelia were processed using a Scientific Industries'Disruptor Genie™(ZYMO RESEARCH,Orange County, California,USA).Genomic DNA was prepared using the ZR Fungal/ Bacterial DNA Kit™(ZYMO RESEARCH).Paired primers,based on specific locations in the expected genomic pattern generated after disruption of ku70by homologous recombination,were used in PCR (see Fig.1).They were set1,ku900and ku1500,set2,ku2210and ptr1,and set3,ku60and ptr800.PCR was carried out under the following conditions in a PERKIN ELMER GeneAmp PCR System2400. Fifty pmol of each primer and about10ng genomic DNA were added to50μl Platinum Blue PCR Supermix(Invitrogen,Carlsbad,California, USA)and subject to30cycles consisting of denaturation at94°C for 30s,annealing at55°C for30s and extension at72°C for2.0min. Similar PCR approaches were used to confirm other gene disruption events(see
below).
Fig.1.Replacement of A.flavus ku70by the ptr selectable marker.(A)Diagram depicting the replacement via double-crossover recombination.(B)PCR analyses of genomic DNA patterns of the recipient,R,and the ku70disruptant,D.The primers used were1:ku900 and ku1500,2:ptr1and ku2210,and3:ptr800and ku60.The DNA size markers(in kb) are lambda DNA/Hind III andØX174RF DNA/HaeIII fragments.
241
P.-K.Chang et al./Journal of Microbiological Methods81(2010)240–246
2.5.Generation of a ku70-and pyrG-deleted strain
A gene knock-in strategy(Bardiya and Shiu,2007)was adopted to generate a pyrG-deleted recipient rather than resorting to mutagen or UV treatment.Construction of the pyrG knock-in vector included cloning pyrG-associated fragments to theflanking regions of A. parasiticus cypA,a major part of which is missing in A.flavus(Ehrlich et al.,2004).A1.0kb5′-untranslated region(UTR)plus coding region and a1.0kb3′UTR plus downstream region of pyrG were generated by PCR using primers pg5HK and pg3Sp,and pg5Sp and pg3Sc,respec-tively.The primers cy280and cy550were used to amplify a2.7kb A. parasiticus cypA-containing fragment.These fragments containing tagged or native restriction sites were cloned sequentially into pUC19. The resulting vector was linearized by KpnI and SacI digestion prior to transformation.Preparation of protoplasts and fungal transformation were performed as described above except that,after transformation, PEG was removed by centrifugation.The protoplasts,after regeneration overnight at30°C in PD
B containing0.6M KCl and uracil(2mg/ml), were spread onto PDA plates which contained0.6M KCl,uracil(2mg/ ml),and5-fluoroorotic acid(FOA,2mg/ml).Disruption of pyrG in a transformant was confirmed by PCR with the primers pg5HK and pg3Sc. The generatedΔpyrG strain lacked230nt in the pyrG3′coding region plus60nt in3′UTR.
e of pyrG-based disruption vectors for identifying genes involved in conidial pigment biosynthesis
Only a few Aspergillus genes have been reported to be involved in conidial pigment biosynthesis,i.e.A.fumigatus alb1,abr1,abr2(a laccase gene=A.nidulans yA)and a yg1(Tsai et al.,1999)and A.nidulans wA (=A.fumigatus alb1)(Mayorga and Timberlake,1992).Homologues of the above genes and several genes encoding laccases that may be involved in pigment formation were identified by BLAST(Schaffer et al., 2001)search of the Aspergillus Comparative Database at Broad Institute (/annotation/genome/aspergil-lus_group/MultiHome.html).Restriction analyses on the identified genes and theirflanking regions were carried out using the DNAMAN software(Lynnon Soft,Vandreuil,Quebec,Canada).DNA fragments specific to theflanking regions of a gene to be targeted were amplified by PCR,digested with appropriate restriction enzymes(Fementas),and inserted into unique sites of pPG28,which contains the A.parasiticus pyrG gene in a 2.7-kb BamHI–SalI fragment(GenBank accession number:EU879956,Fig.2A).The PCR primers used are listed in Table2.Mycelia for the preparation of protoplasts were obtained from conidia of theΔpyrG mutant grown in PDB containing0.5mg uracil/ml shaken at150rpm for20h at30°C.The disruption vectors were linearized prior to transformation to yield DNA ends that are identical to the targeting sites.
2.7.Replacement of the inserted ptr marker by a reusable pyrG selectable marker
A gene replacement protocol was used to restore the pyrithiamine sensitivity of thefirst createdΔpyrG transformation recipient strain.A 1.4kb5′-UTR of ku70was amplified by PCR using primers ku5Sm and ku5X.A1.7kb3′-UTR of ku70was amplified using primers ku3X and ku3S.The two fragments were cloned sequentially into the corresponding sites in pUC19to give pKu5+3.A direct repeat-recombination strategy was the basis for generating a reusable pyrG marker used to replace the ptr dominant selectable marker.To this end,the R region in Fig.2A was amplified with primers pgXho and pgSal.The PCR fragment after digested by XhoI and SalI was used to replace the1.0kb XhoI–SalI region(right side of Fig.2A),which resulted in a pyrG markerflanked by two0.5kb direct repeats(R-pyr-R);a putative polyadenylation signal,AATAA,is located about10nt before the XhoI site.The R-pyr-R fragment generated after BamHI and SalI digestion was cloned into the XbaI site of pKu5+3by blunt-end ligation.The resulting vector was digested with HindIII and SmaI(Fementas)prior to transformation.
Table1
Oligoprimer designations and their sequences.
Primer Sequence
ku94H CTGAAAGCTTCGGAGGCTAAC
ku600P ATACTGCAGGGTCATCATTATCGGTGACT
ku1650P CTTCCTGCAGAGAAACTCTGG
ku2150K TGAGGAACAGGTACCGTAAGC.
ku60CGACGAGAGTGTACACACTT
ku270CGGATGAGTTGGAGCTGAAG
ku900TCAAGATCTGTCCCACGG
ku1500TGACGGACGTCATCAGCG
ku2210TCCACACGCTCAACGAGATC
ku2540GACTGCAACGTTGCTGGTAC
ku5Sm CTTCGCCCGGGTACGGGTCACCTAATC
ku5X TATCTAGAGTCGTAAGTCATGAATTGCGT
ku3X ATTCTAGACAACGCTAGTATTGGTTACGAG
ku3S CTAGAACGAATTCGTGTCGACACTGA
ptrU730P ATACTGCAGACGGGCAATTGATTACG
ptr1230P TTACTGCAGCCGCTCTTGCATCTTTG
ptr1TGGCAGCTGGAGGAGACATG
ptr800CCTTCTGTGCGAAGCGCTTG
pg5HK ATTAAGCTTATTGCTATGTCCCTGAAAG
pg3Sp ATTGCATGCTAACTTCAGACTGAACCTC
pg5Sp TATGCATGCACTCGAAATGACTACTACTAT
pg3Sc TGAGTCTAGCTGAGCTCGGCTC
pgXho ATACTCGAGATCTCAGAACAATATACCAG
pgSal ATAGTCGACCGGCTTATTCAGTAGATT
cy280AATGCTAGCTTGTGTGGATTCGTGAGTGTC
cy550ATAGCTAGCATTGCTCTGCATACTCGGAC
laeA5Sp CGATTAGTTCGTTGAACTGTCA
laeA5S AATGTCGACTGTGAGTAGTACGAGTCG
laeA3B ATAGGATCCACA AATTATTCACGGTG
laeA3Sc TGGCACCACACAAGCTCATATC
laeA243ATAGTCGACTTACCGGACAGTGCAAGG
laeA2897TAAGTCGACAAGAGCTGCATCGCGATGTA
tfR5Sp CCGGCATGCCTAGACAGACAATCAC
tfR5S TATGTCGACCTCACGTCTGTGCAGGCC
tfR3B GTCGGATCCACATCAAAGAGGGATACT
tfR3Sm
ATAGCCCGGGTAATGTCGTTGGTC
Fig.2.The original and the reusable pyrG markers for fungal transformation.(A)The
2.7kb BamHI–SalI fragment that contains the A.parasiticus pyrG gene inserted into the
multiple-cloning-site region of pUC19(pPG28).E,EcoRI*;Sc,SacI*;K,KpnI;Sm,SmaI*;
B,BamHI*;P,PstI;Xh,XhoI*;S,SalI*;Sp,SphI*;H,HindIII*.The symbol*indicates
unique restriction sites.(B)Schematic representation of the forced recombination
between the R repeat regions under FOA positive selection to regain uracil auxotrophy. 242P.-K.Chang et al./Journal of Microbiological Methods81(2010)240–246
2.8.Determination of frequencies of self-resolution of the reusable pyrG marker on different media
Conidia were harvested from a PT-sensitive strain,whose previously inserted ptr marker had been replaced by the reusable pyrG (R-pyr -R)marker.Different culture media were used to examine the selection ef ficiency for the resolved auxotrophic mutants.Approximately 105,106,and 107conidia were spread onto PDA plates which contained 2mg uracil/ml and 2mg FOA/ml,and CZ(NH 4+)plates which contained 2mg uracil/ml,2mg FOA/ml,and 5mM ammonium sulfate.The plates were incubated at 30°C for 7to 10days.The ku70-speci fic primers ku270and ku2540were used to con firm forced resolution (loop-out)of the pyrG marker leaving only one copy of the R region in the ku70locus (Fig.2B).
2.9.Deletion of laeA by R-pyrG-R and re-creation of a uracil auxotrophic ΔlaeA mutant
Using similar steps described in Section 2.2,we constructed a laeA -disruption vector based on the R-pyr -R marker with the following primers:laeA5Sp,laeA5S,laeA3B,and laeA3Sc to amplify the two flanking regions used in targeting laeA via double-crossover recombi-nation.The resulting vector was linearized with SphI and SacI prior to transformation.Putative ΔlaeA mutants were selected based on changes in colony morphology and loss of a flatoxin production.Disruption of laeA was con firmed by PCR analyses of the genomic patterns of the transformants (data not shown).Approximately 2×106conidia of a con firmed ΔlaeA mutant were spread onto CZ(NH 4+)plates,which contained 2mg uracil/ml,2mg FOA/ml,and 5mM ammonium sulfate,for the generation of uracil auxotrophic ΔlaeA mutants.
2.10.Reintroduction of full-length genomic laeA into an A.flavus ΔlaeA mutant
The laeA gene was reintroduced into the ctfR2gene locus (AFL2G_07245.2)located in a subtelomeric region of chromosome 3.Disruption of ctfR2had no effect on the production of a flatoxin,cyclopiazonic acid,nor on gross morphology (unpublished results).The primer pair,tfR5Sp and tfR5S,and the primer pair,tfR3B and tfR3Sm were used to amply a 5′and a 3′regions of ctfR2,respectively.The two PCR fragments were cloned into corresponding sites in pUC19followed by insertion of the A.parasiticus pyrG gene.The full-length laeA gene was ampli fied from A.flavus CA14genomic DNA template using Accu-Prime ™Pfx PCR Supermix (Invitrogen)with primers laeA243and laeA2897each tagged with a SalI site.The 2.7kb laeA -containing SalI –SalI fragment was cloning into the SalI –XhoI sites after the 1.2kb SalI –XhoI fragment downstream of the pyrG gene (see Fig.2A)was removed.The resulting targeting vector was digested with HindIII and SphI prior to transformation.The primers laeA243and laeA2897were used in PCR to con firm the presence of the full-length laeA gene in the comple-mented transformants.
2.11.Thin-layer chromatography (TLC)analysis of a flatoxin B 1
The transformants on the regeneration plates (PDA supplemented with 0.6M KCl)putatively complemented by the full-length laeA were transferred onto PDA plates for TLC analysis.One PDA agar plug was cored from a 5day-old transformant culture plate grown at 30°C,placed into a microfuge tube and extracted with 0.2ml of acetone for 1h.Ten microliter of each extracts was spotted onto a Si250TLC silica gel plate (J.T.BAKER,Phillipsburg,New Jersey,USA).The metabolites were resolved with a solvent system of toluene:ethyl acetate:acetic acid (80:10:10,vol/vol/vol).3.Results
3.1.Replacement of ku70by the dominant ptr selectable marker Growth of A.flavus CA14and CA14N1was inhibited at 0.01μg PT/ml.Therefore,0.1μg PT/ml was chosen as the selection concentration.Two independent transformation experiments yielded a total of 102PT-resistance colonies.PCR analyses of the genomic DNA from 80transformants showed that two transformants were ku70knockouts.Deletion of ku70was con firmed with primers speci fic to the ku70coding region,ptr downstream and upstream regions,and regions beyond the expected homologous recombination sites (Fig.1A).No PCR products were generated from the genomic DNA of the ku70knockout when primers ku900and ku1500were used.In contrast,these primers yielded a 0.6kb PCR fragment from the recipient's genomic DNA (Fig.1B).As expected,primers ptr1and ku2210,which amplify a small region beyond the expected integration site i.e.,ku2150and the upstream region of ptr (Fig.1A),generated a 1.4kb PCR fragment from the genomic DNA of the ku70knockout.Likewise,primers ptr800and ku60yielded a 1.0kb PCR fragment,expected from another flanking region after ku70was targeted by ptr through homologous integration.The two regions were not present in the recipient's genome.These results showed that the ptr marker had replaced the ku70gene in the A.flavus genome.
e of the Δku70ΔpyrG strain to identify conidial pigment biosynthetic genes
The ku70-defective genetic background and the positive FOA selection facilitated the generation of ΔpyrG mutants that produced white-colored conidia on regeneration plates (data not shown).A Δku70ΔpyrG strain was used as the transformation recipient in the identi fication of conidial pigment genes.Of the nine genes disrupted two genes,AFL2G_09923.2and AFL2G_09924.2,were con firmed to be involved in conidial pigment biosynthesis (Table 2).The AFL2G_09923.2knockouts produced expected white conidia while knockouts of AFL2G_09924.2,a homolog of A.fumigatus abr2(br:brown)and A.nidulans yA (y:yellow),produced olive-green conidia not reported before in Aspergillus species (Fig.3A).They were named wA and olgA ,
Table 2
PCR primers used in the construction of disruption vectors for identifying conidial pigment genes.Gene locus
a
5′Flanking region
3′Flanking region
Gene
AFL2G_00330.2cacggcccgggatgtcacta gtatcgggatccaccttccctcctt cggtttgagcaagcttagaatc gctggaagatcgtcgaccctgtgaa ayg1
AFL2G_09923.2gcagcttataggagaattcact gccgactggatccctctgtgt
attgtcgacttccgatactatcta caatgcatgcaatacttaccgatg alb1(wA )
AFL2G_09924.2acgtattggtagcatgctcacgc tgcgtcgacagctttaagccacgcggc ttcgaagagctccggtctttccgt catggatccacgagcacccgatgt abr2(yA )A.flavus olgA AFL2G_09962.2atggaacatcacccgggtattggcca tatggatccaatgatgagatgtcag tacgtcgacttcaaacttgtccctg tcacttgcgtcgcatgcctg abr1AFL2G_08008.2cctatctggtgcatgcggtgaacttg gttgcattgagtcgacgccaggc gatgaggaggatccctacattg gtcgagtacagaattcgaact lac1AFL2G_09420.2cgcgtttaattcggcatgca ggaagtcgacacgggcagtg ctagtggatccatcccacaga cgagattggaattccccggg lac2AFL2G_10583.2ttgctgggagcatgcctgtatcac gttcatggtcgacaaccatac cgaacagcggatccactgtattg catgcttggcttgtttgatcg
lac3AFL2G_11132.2ctacggcatgcccgggtgacacag atcgcgtcgacacggatagg tataggatccgcgctgccaac atgggaattcccgggataagacatgg lac4AFL2G_11750.2
cgtgcgtcactatgcatgcagg catcatgggtctgtcgacgccatc
ggtgatggtgacacagctggtcaa cacaagaactagaattcaagacgg
lac5
a
/annotation/genome/aspergillus_group/MultiHome.html .
243
P.-K.Chang et al./Journal of Microbiological Methods 81(2010)240–246
respectively.The con firmed knockouts of each of the rest seven genes including homologs of A.fumigatus abr1and ayg1produced yellowish-green conidia same as those of the A.flavus parental strain (data not shown).The overall gene-targeting frequencies estimated from all the experiments ranged from 80%to 100%.The locations of these genes were tentatively assigned to the A.flavus genome using the chromo-somal map of A.oryzae (http://www.bio.nite.go.jp/dogan/MicroTop?GENOME_ID=ao ).The wA and olgA genes are clustered on chromosome 4,and AFLG_09962.2,a homolog of A.fumigatus abr1(Tsai et al.,1999),is located about 100kb away.Fig.3B shows the genomic patterns of some of the knockouts compared to those of the recipient strain as con firmed by PCR with primers encompassing the targeting region.They were 4.3kb vs.1.7kb for AFL2G_09962.2,4.1kb vs.1.5kb for olgA ,4.7kb vs.3.5kb for wA ,and 5.0kb vs.2.3kb for AFL2G_00330.2.
3.3.Restoration of PT sensitivity and uracil auxotrophy in the original recipient
A drawback of many developed transformation systems based on single selectable markers is the loss of auxotrophy or drug sensitivity after transformation.In this study,the ptr marker was readily replaced by the reusable pyrG marker (R-pyr -R)which contains two direct repeats of a 5′UTR region (Fig.2B),and the uracil auxotrophy was
recovered from FOA selection.The estimated frequencies of self-resolution of the R-pyr -R marker reached 100%on CZ(NH 4+)and PDA media.The PTs Δku70ΔpyrG derivatives containing a single copy of the 5′UTR (R)were easily generated on both media (Fig.4A and B.Although CZ(NH 4+)yielded smaller colonies than PDA,it gave more than 5-fold higher ΔpyrG derivatives than PDA (Table 3).
3.4.Demonstration of the ef ficacy of the improved system by reintroducing laeA
To test the utility of the developed system,we disrupted the laeA gene,a major regulatory gene of secondary metabolism (Bok and Keller,2004),in a PTs Δku70ΔpyrG strain (data not shown),regenerated the uracil auxotrophy by forcing out the reusable pyrG marker,and restored the lost a flatoxin-producing ability by reintro-ducing an intact copy of laeA via a new round of transformation based on the pyrG selectable marker.Five of the six transformants examined produced a flatoxin B 1(Fig.5A),and the result was consistent with the presence of the intact laeA gene in the a flatoxin-producing transfor-mants (Fig.5B).4.Discussion
We combined available selectable markers for fungal transforma-tion and formulated an ef ficient gene-targeting protocol for A.flavus .The demonstrated ef ficacy of this system indicates that the heterol-ogous genes are functional in A.flavus .An important consideration for high-throughput functional genomics is to minimize the time in selecting correct gene knockouts,that is,only a very small number of transformants should be examined before one is identi fied.The ku70gene is critical for DNA repair via the nonhomologous end-joining (NHEJ)pathway,and its impairment greatly reduces the frequency of heterologous integration of transforming DNA.The gene-targeting frequencies of the NHEJ-de ficient A.flavus system are well within
the
Fig.3.Identi fication of conidial pigment genes.(A)Colony morphology of AFL2G_09962.2(top),AFL2G_09924.2(olgA ,bottom left),and AFL2G_09923.2(wA ,bottom right)disruptants after growth at 30°C for 5days on PDA.(B)Con firmation of disruption of AFL2G_09962.2(9962),oligA ,wA and AFL2G_00330.2(0330).M:1kb DNA ladder,A:recipient strain,B:
disruptant.
Fig. 4.Determination of self-resolution frequencies on different media.(A)Colony morphology of FOA-resistant mutants.(B)PCR con firmation of deletion of the pyrG marker.C:PTs Δku70;1–4:independent derivatives.The lack of products in C was due to the presence of the R repeats in the R-pyrG -R marker which interfered PCR ampli fication.
244P.-K.Chang et al./Journal of Microbiological Methods 81(2010)240–246
ranges of what have been reported for a single homologous insertion in other fungi(da Silva Ferreira et al.,2006;Ninomiya et al.,2004; Takahashi et al.,2006).The generation of the A.flavus uracil auxotrophic mutant by the knock-in strategy based on FOA resistance can be easily adopted for other fungi.This approach eliminates the common practice of mutagen treatments which often result in genetic changes.Although these changes are not always morphologically apparent,they may complicate functional studies.
A drawback of past developed transformation systems for A.flavus and many other fungi is the lack of double selectable markers and double mutants suitable for gene manipulation,for example gene knockout experiments followed by genetic complementation.The creation of necessary mutants by conventional approaches is a formidable task.The experimental steps can be adopted and used to readily generate a highly efficient system that consists of a reusable selection and second selection as the described uracil auxotrophy and pyrithiamine sensitivity to meet the prerequisites.It can be achieved byfirst knocking out an NHEJ-associated gene with either an auxotrophic marker,such as the nitrate reductase gene(niaD)in a spontaneous niaD mutant(Malardier et al., 1989;Pereira et al.,2004;Whitehead et al.,1990)or with a dominant marker,such as the aforementioned ptr,ble and sdhB(cxr)genes(He et al.,2007;Shima et al.,2009)to facilitate subsequent rounds of gene-targeting.
The refined system has been used successfully to disrupt and reintroduce a gene,such as laeA,a regulatory gene of secondary metabolism(Bok and Keller,2004)into a specific genome locus to restore the lost aflatoxin production(Fig.5).The NHEJ-deficient background of the recipient stain also allows integration of a circular vector containing sequence regions identical to a genomic portion via singe-crossover recombination.Based on pyrG we used this approach and genetically complemented an A.flavus knockout mutant of msnA (unpublished results),the orthologue of Saccharomyces cerevisiae MSN2necessary for cells to cope with a broad range of stresses(Ruis and Schuller,1995).The added benefit of this system includes the restored pyrithiamine sensitivity,upon which the dominant ptr marker can be used as an alternative in double knockout or genetic complementation experiments to provide greater versatility. Acknowledgment
We thank Alice Yeh of University of Virginia for technical assistance.
References
Bardiya,N.,Shiu,P.K.,2007.Cyclosporin A-resistance based gene placement system for Neurospora crassa.Fungal Genet.Biol.44,307–314.
Bok,J.W.,Keller,N.P.,eA,a regulator of secondary metabolism in Aspergillus spp.Eukaryot.Cell3,527–535.
Cary,J.W.,O'Brian,G.R.,Nielsen,D.M.,Nierman,W.,Harris-Coward,P.,Yu,J.,Bhatnagar,
D.,Cleveland,T.
E.,Payne,G.A.,Calvo,A.M.,2007.Elucidation of veA-dependent
genes associated with aflatoxin and sclerotial production in Aspergillusflavus by functional genomics.Appl.Microbiol.Biotechnol.76,1107–1118.
Chang,P.-K.,Hua,S.S.,2007.Molasses supplementation promotes conidiation but suppresses aflatoxin production by small sclerotial Aspergillusflavus.Lett.Appl.
Microbiol.44,131–137.
da Silva Ferreira,M.E.,Kress,M.R.,Savoldi,M.,Goldman,M.H.,Hartl,A.,Heinekamp,T., Brakhage, A.A.,Goldman,G.H.,2006.The akuB(KU80)mutant deficient for nonhomologous end joining is a powerful tool for analyzing pathogenicity in Aspergillus fumigatus.Eukaryot.Cell5,207–211.
Duran,R.M.,Cary,J.W.,Calvo,A.M.,2007.Production of cyclopiazonic acid,aflatrem, and aflatoxin by Aspergillusflavus is regulated by veA,a gene necessary for sclerotial formation.Appl.Microbiol.Biotechnol.73,1158–1168.
Ehrlich,K.C.,Chang,P.-K.,Yu,J.,Cotty,P.J.,2004.Aflatoxin biosynthesis cluster gene cypA is required for G aflatoxin formation.Appl.Environ.Microbiol.70,6518–6524. FAO,1997.Worldwide Regulations for Mycotoxins1995.A Compendium.Rome,Italy, FAO Food and Nutrition.Paper64.
Guzman-de-Pena,D.,Pena-Cabriales,J.J.,2005.Regulatory considerations of aflatoxin contamination of food in tinoam.Microbiol.47,160–164.
He,Z.M.,Price,M.S.,Obrian,G.R.,Georgianna,D.R.,Payne,G.A.,2007.Improved protocols for functional analysis in the pathogenic fungus Aspergillusflavus.BMC Microbiol.7,104. Hedayati,M.T.,Pasqualotto,A.C.,Warn,P.A.,Bowyer,P.,Denning,D.W.,2007.Aspergillus flavus:human pathogen,allergen and mycotoxin producer.Microbiology153, 1677–1692.
Horng,J.S.,Chang,P.-K.,Pestka,J.J.,Linz,J.E.,1990.Development of a homologous transformation system for Aspergillus parasiticus with the gene encoding nitrate reductase.Mol.Gen.Genet.224,294–296.
Hua,S.S.,Tarun,A.S.,Pandey,S.N.,Chang,L.,Chang,P.-K.,2007.Characterization of AFLAV,a Tf1/Sushi retrotransposon from Aspergillusflavus.Mycopathologia163,97–104. Kubodera,T.,Yamashita,N.,Nishimura,A.,2000.Pyrithiamine resistance gene(ptrA)of Aspergillus oryzae:cloning,characterization and application as a dominant selectable marker for transformation.Biosci.Biotechnol.Biochem.64,1416–1421. Malardier,L.,Daboussi,M.J.,Julien,J.,Roussel,F.,Scazzocchio,C.,Brygoo,Y.,1989.
Cloning of the nitrate reductase gene(niaD)of Aspergillus nidulans and its use for transformation of Fusarium oxysporum.Gene78,147–156.
Mayorga,M.E.,Timberlake,W.E.,1992.The developmentally regulated Aspergillus nidulans wA gene encodes a polypeptide homologous to polyketide and fatty acid synthases.Mol.Gen.Genet.235,205–212.
Meyer,V.,Arentshorst,M.,El-Ghezal,A.,Drews,A.C.,Kooistra,R.,van den Hondel,C.A., Ram,A.F.,2007.Highly efficient gene targeting in the Aspergillus niger kusA mutant.
J.Biotechnol.128,770–775.
Mizutani,O.,Kudo,Y.,Saito,A.,Matsuura,T.,Inoue,H.,Abe,K.,Gomi,K.,2008.A defect of LigD(human Lig4homolog)for nonhomologous end joining significantly improves efficiency of gene-targeting in Aspergillus oryzae.Fungal Genet.Biol.45,878–889. Ninomiya,Y.,Suzuki,K.,Ishii,C.,Inoue,H.,2004.Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining.Proc.Natl.Acad.Sci.
USA101,12248–12253.
Otsuki,T.,Wilson,J.S.,Sewadeh,M.,2001.What price precaution?European harmoniza-tion of aflatoxin regulations and African groundnuts exports.Eur.Rev.Agric.Econ.28, 263–284.
Payne,G.A.,Nierman,W.C.,Wortman,J.R.,Pritchard, B.L.,Brown, D.,Dean,R.A., Bhatnagar,D.,Cleveland,T.E.,Machida,M.,Yu,J.,2006.Whole genome comparison of Aspergillusflavus and A.oryzae.Med.Mycol.44(Suppl),9–11.
Table3
Self-resolution frequencies of the R-pyrG-R selectable marker on media supplemented with FOA.
Medium Number of spores FOA-resistant colony a Frequency(%)b
CZ(NH4+)1051±1–c
10612±3100
107113±11100
PDA1050±0–
1061±1–
10718±6100
a Average±SD.
b Frequency was estimated based on four independent colonies examined.
c Not
determined.
Fig. plementation of aΔlaeA strain with an amplified genomic laeA fragment.
(A)Restoration of aflatoxin in the transformants(B)Confirmation of the presence of the introduced laeA in the aflatoxin-producing transformants.M:DNA1-kb ladder.Transfor-mants1to6are the same in A and B.245
P.-K.Chang et al./Journal of Microbiological Methods81(2010)240–246。