Alterations in Wnt pathway activity in mouse serum and kidneys during lupus development

ARTHRITIS&RHEUMATISMVol.63,No.2,February2011,pp513–522DOI10.1002/art.30116©2011,American College of RheumatologyAlterations in Wnt Pathway Activity in Mouse Serum and Kidneys During Lupus DevelopmentAnders Aune Tveita and Ole Petter RekvigObjective.The canonical Wnt/␤-catenin pathway was recently identified as a factor in the pathogenesis of several renal diseases.The aim of this study was to evaluate Wnt signaling activity during disease develop-ment in a murine model of lupus nephritis.Methods.Wnt activity and Dkk-1expression were serially assayed in the serum and kidneys of(NZB؋NZW)F1mice during progression of lupus nephritis. The effects of serum obtained from mice with lupus and serum-equivalent concentrations of Dkk-1on mesangial cells were assessed in vitro.Results.Gene expression analyses revealed in-creased canonical Wnt pathway activity in kidneys during development of lupus nephritis,paralleled by an increase in renal and serum levels of the Wnt inhibitor Dkk-1.Sera obtained from proteinuric-stage(NZB؋NZW)F1mice showed strong Wnt-inhibitory effects in vitro.Dkk-1concentrations comparable to those ob-served in lupus-prone mice induced apoptosis in tubular and mesangial cells in vitro,whereas no such effect was seen for the range of concentrations observed in young prediseased mice and control BALB/c mice.Conclusion.These data demonstrate that renal Wnt signaling activity is increased in lupus and is accompanied by an increase in renal and serum levels of Dkk-1.The Wnt pathway is involved in the turnover of extracellular matrix constituents and represents a po-tential mediator of the morphologic changes that occur within the glomerulus during the development of ne-phritis.Furthermore,increased levels of Dkk-1serve as a potential proapoptotic stimulus in vitro and possibly in vivo and could be an important element in the initiation and progression of systemic and end-organ disease manifestations in systemic lupus erythemato-sus.The Wnt signaling pathway is an intracellular signaling cascade that was initially linked to embryogen-esis and cancer development(1).Understanding of the roles of Wnt signaling in postembryonic mammals is currently increasing,and during the last few years, interest in this signaling network has increased due to the discovery of its involvement in several important physiologic and pathophysiologic conditions.The classic, so-called canonical Wnt pathway is activated through binding of Wnt agonist proteins to members of the Frizzled family of receptors.This interaction initiates an intracytoplasmic signal transduction cascade that pre-vents glycogen synthase kinase3␤(GSK3␤)–mediated degradation of␤-catenin,followed by translocation of ␤-catenin into the nucleus,where it associates with the T cell factor/lymphocyte enhancement factor(TCF/LEF) family of transcription factors.These transcription fac-tors activate a variety of target genes involved in cellular growth and differentiation.The canonical Wnt/␤-catenin pathway is tightly regulated by several secreted antagonists,including the secreted Frizzled-related pro-teins,Wnt inhibitory factor,and the Dickkopf protein family.Of these,Dkk-1is a specific inhibitor of canon-ical Wnt/␤-catenin signaling and has been studied in the context of regulation of the Wnt pathway(2).Systemic lupus erythematosus(SLE)is an auto-immune disease characterized by the development of autoreactivity against nuclear antigens,including double-stranded DNA(dsDNA).In(NZBϫNZW)F1 (NZB/NZW)mice,a lupus-like disease develops spon-taneously and is complicated by severe,progressive nephritis.The production of circulating anti-dsDNA autoantibodies is accompanied by the deposition of immune complexes within extracellular matrices,partic-Supported by the Northern Norway Regional Health Author-ity Medical Research Program(grants SFP-100-04and SFP-101-04). Dr.Rekvig received Milieu support from the University of Tromsø.Anders Aune Tveita,MD,PhD,Ole Petter Rekvig,MD, PhD:Institute of Medical Biology,University of Tromsø,Tromsø, Norway.Address correspondence to Anders Aune Tveita,MD,PhD, Molecular Pathology Research Group,Institute of Medical Biology, University of Tromsø,N-9037Tromsø,Norway.E-mail:anders.aune. tveita@uit.no.Submitted for publication May8,2010;accepted in revised form October21,2010.513ularly the glomerular basement membrane.This process is commonly accompanied by the apparent expansion of extracellular matrices.The initiating mechanisms re-main unknown but are thought to involve signaling pathways triggered by the deposited immune complexes.In the current study,we analyzed whether the Wnt signaling pathway may be involved in progression of lupus nephritis,based on emerging reports indicative of a role of this pathway in renal extracellular matrix homeostasis.Increased renal Wnt signaling was recently observed in various models of renal fibrosis,including unilateral ureteral obstruction(3,4).In this model,acti-vation of the Wnt/␤-catenin pathway caused increased interstitial expression of extracellular matrix constitu-ents,including type I procollagen and fibronectin(4). Moreover,inhibition of Wnt signaling by overexpression of the secreted Wnt antagonist Dkk-1attenuated inter-stitial collagen matrix accumulation and the severity of renal fibrosis(4).These data point to Wnt signaling as a potential intervention target in fibrotic and possibly inflammatory renal disease processes(5).In addition, increased Wnt signaling has been shown to induce the expression of matrix metalloproteinases(MMPs)(6,7), which may be of importance in extracellular matrix remodeling and the loss of membrane integrity that occur in lupus nephritis(8).Less is known about the roles of Wnt signaling in glomerular cells and diseases affecting the glomerular compartment.A recent study revealed that adriamycin-induced nephropathy caused Wnt/␤-catenin signaling in podocytes and demonstrated a crucial role of␤-catenin expression in the consequent development of protein-uria(9).Increased␤-catenin expression was also dem-onstrated in biopsy specimens obtained from patients with diabetic nephropathy and focal segmental glomer-ulosclerosis(9).Although the spectrum of effects of renal Wnt signaling remains incompletely characterized, these data are suggestive of a role of Wnt/␤-catenin signaling in several glomerulopathies(9).Based on these results and as part of the ongoing effort to characterize the molecular changes underlying the development and progression of lupus nephritis,we evaluated renal Wnt signaling in NZB/NZW mice at different stages of disease progression.Various disturbances in the clearance of apopto-tic cells have been reported and are thought to play a role in the development of SLE(10,11),but key ele-ments in the pathogenesis of the disease are still un-known.Conceivably,surpassing the capacity for apopto-tic cell clearance could trigger a local inflammatory reaction via the exposure of endogenous danger signals (12).Under such circumstances,apoptotic cell antigens are taken up by antigen-presenting cells(e.g.,dendritic cells)that have been activated by proinflammatory signals.This allows for immunogenic presentation of self antigens,which might launch and maintain an auto-immune response(for review,see ref.13).In this respect,an increased load of apoptotic cells has been proposed to inhibit clearance mechanisms(14).An emerging aspect of Wnt signaling seems to be its role in the protection of cells against apoptosis upon exposure to various types of cellular stress,at least in vitro(15,16). The aim of the current study was to evaluate whether alterations in Wnt pathway activity could influence the apoptotic cell load during the development of lupus in NZB/NZW mice.MATERIALS AND METHODSAnimals,tissue samples,and cell culture.Female NZB/NZW mice and BALB/c mice were purchased from Harlan.The treatment and care of the mice were performed in accordance with the guidelines of the Norwegian Ethical and Welfare Board for Research Animals,and the study was approved by the Institutional Review Board.Serum samples from NZB/NZW mice and BALB/c mice were collected every second week and stored atϪ20°C. Proteinuria in NZB/NZW mice was monitored weekly by semiquantitative dipstick measurements(Bayer).At the age of 10weeks and20weeks or upon development of overt nephritis (proteinuriaϾ3gm/liter),mice were killed by CO2suffocation. The kidneys were extirpated,cut,and preserved in RNAlater (Qiagen)for further analysis of gene expression or were snap-frozen in liquid nitrogen.Mouse mesangial cells were obtained from the Amer-ican Type Culture Collection and cultured in Dulbecco’s modified Eagle’s medium/Nutrient Mixture F-12Ham(Sigma-Aldrich)with20%fetal bovine serum,2m M L-glutamine, 50m M penicillin,and50m M streptomycin.Clonetics human renal proximal tubular epithelial cells(Lonza)were main-tained in serum-free renal epithelial cell culture medium with supplements provided by the manufacturer.All cells used were from passage4.Recombinant human and mouse Dkk-1were obtained from R&D Systems.RNA extraction and complementary DNA(cDNA) synthesis.Total RNA was isolated from RNAlater-preserved kidneys(5mice in each group)using EZ1RNA Tissue Mini Kit(Qiagen).The concentration of extracted RNA was deter-mined spectrophotometrically with a NanoDrop spectrophoto-meter.Samples(2␮g RNA in100-␮l reaction mixture)were reverse transcribed into cDNA with random primers,using a High Capacity cDNA Reverse Transcription Kit(Applied Biosystems).Real-time polymerase chain reaction(PCR).Quanti-tative PCR was performed using an ABI Prism7900HT Sequence Detection System(Applied Biosystems).Prede-signed FAM-labeled primer/probe sets(Applied Biosystems) specific for the analyzed genes(Axin2,accession no. Mm00443610_m1;Actb,accession no.Mm00607939_s1;Dkk1, accession no.Mm00438422_m1;Myc,accession no. Mm00487803_m1;Mycn,accession no.Mm00627179_m1;514TVEITA AND REKVIGPpard,accession no.Mm00803184_m1;Lef1,accession no. Mm01310389_m1)were used,and TATA box binding protein (accession no.Mm00498583_m1)was used as an endogenous control.FAM-labeled primer/probe sets for additional TCF/ LEF-responsive genes were obtained from Integrated DNA Technologies,and the sequences are shown in the legend of Table1.The relative expression levels were calculated usingthe⌬⌬Ct method.Normalization was accomplished by com-paring the relative expression for each sample with that for one of the4-week-old control BALB/c mice.For cell culture experiments,samples were normalized against untreated con-trols.Immunofluorescence microscopy.Four-micrometer–thick OCT compound–embedded cryostat sections of kidney were blocked with10%calf serum and1%bovine serum albumin(BSA)in phosphate buffered saline(PBS).The sections were subsequently incubated with a rabbit anti-human Dkk-1polyclonal antibody,rabbit anti-human phosphorylated glycogen synthase kinase3␤(GSK3␤;Santa Cruz Biotechnol-ogy),or a rabbit anti-human␤-catenin polyclonal antibody (Abcam)followed by incubation with an Alexa546–conjugatedanti-rabbit F(abЈ)2secondary antibody(Invitrogen).Normalrabbit IgG was used as a negative control.For immunostaining using a mouse anti-human acti-vated␤-catenin monoclonal antibody(Millipore),ultrathin zinc-fixated cryosections were incubated with0.1mg/ml anti-mouse F(abЈ)2overnight at4°C to reduce background staining by in vivo–bound antibodies.Sections were then processed as described above.All sections were run in parallel,with the omission of the primary antibody to evaluate background staining for each section.Anti-dsDNA and anti–Dkk-1enzyme-linked immu-nosorbent assay(ELISA).Serum antibodies against calf thy-mus dsDNA were detected and titrated by standard indirect ELISA,as previously described(17).A murine monoclonal anti-dsDNA antibody was included as an intraassay control for the cutoff level(18).Detection of serum Dkk-1was performed using the mouse Dkk-1DuoSet ELISA kit(R&D Systems) according to the supplied protocol.Serum samples were diluted1:6in PBS with1%BSA.Protein isolation and Western blot analysis.Protein extracts were prepared from snap-frozen kidney tissue by homogenization in Tris buffer(0.5moles/liter Tris HCl,pH 7.5,150mmoles/liter NaCl).The samples were then centri-fuged for5minutes,and the supernatant was collected. Nuclear and nucleus-depleted lysates were prepared from 20-mg pieces of snap-frozen lyophilized kidney tissue,using the Pierce Nuclear and Cytoplasmic Extraction Reagent Kit. Total protein was measured,and the protein content of the samples was normalized using the Pierce BCA Protein Assay.Sodiumdodecylsulfate–polyacrylamidegelelectrophor-esis and Western blotting were performed according tostan-Figure1.Wnt/␤-catenin pathway activity in(NZBϫNZW)F1(NZB/NZW;B/W)mouse kidneys.Real-time polymerase chain reaction analysis was performed on RNA isolated from NZB/NZW and BALB/c mice of different ages(nϭ5per age group).Gene expression data are shown for ␤-catenin(A)and the T cell factor/lymphocyte enhancement factor–regulated genes Axin2(B),Ppard(C),and Lef1(D).These data demonstrate an increase in gene expression during progression toward proteinuria.Gene expression in BALB/c mice of corresponding ages remained stable or decreased with increasing age.Expression levels were normalized against that of TATA box binding protein and are expressed as fold change values relative to8-week-old mice,using the⌬⌬C t method.Values are the meanϮSEM.ءϭPϽ0.05;ءءϭPϽ0.01;ءءءϭPϽ0.001.Wnt PATHWAY AND Dkk-1IN SYSTEMIC LUPUS ERYTHEMATOSUS515dard procedures.Membranes were blocked with5%(weight/ volume)BSA and probed with the relevant primary antibody overnight at4°C.Membranes were washed and incubated with a horseradish peroxidase–conjugated secondary antibody,and binding was assayed by chemiluminescence detection.The determination of molecular weight was performed using MagicMark XP molecular weight markers(Invitrogen).Flow cytometry.Cell samples were analyzed on a FACSCalibur cytometer(BD Biosciences).Apoptosis was detected using an annexin V–fluorescein isothiocyanate and propidium iodide staining kit(BD Biosciences)according to the protocol supplied by the manufacturer.Data were analyzed using CellQuest software(BD Biosciences).Statistical analysis.Results are presented as the meanϮparisons between groups were performed by one-way analysis of variance followed by Bonferroni’s correction for multiple comparisons,using GraphPad Prism version5.0.P values less than0.05were considered significant.RESULTSIncreased expression of messenger RNA(mRNA) for␤-catenin and TCF/LEF-responsive genes in kidneys from preproteinuric-and proteinuric-stage NZB/NZW mice.Real-time PCR analysis of mRNA isolated from kidney homogenates revealed an increase in the expres-sion of␤-catenin,occurring atϳ20weeks and further increasing during the progression toward proteinuria (Figure1A).This increase in gene expression paralleled the appearance of significant titers of anti-dsDNA auto-antibodies(see below).In contrast,␤-catenin was stably expressed at a lower level in age-matched BALB/c mice (Figure1A).In order to determine whether the increase in␤-catenin expression was a reflection of increased Wnt activity,the mRNA expression of several known TCF/LEF-responsive genes,including Axin2,Ppard, Myc,Lef1,and RhoU(19,20),was assayed.The results revealed a consistent increase in the expression of these genes in NZB/NZW mice(Figures1B–D and Table1) that paralleled the increase in␤-catenin mRNA expres-sion,suggesting that canonical Wnt signaling is in-creased within the kidneys during the development of lupus nephritis.In contrast,a reduction in Wnt pathway activity with increasing age was seen in BALB/c mice (data not shown).Immunofluorescence studies of kidney biopsy specimens revealed an increase in total␤-catenin stain-ing throughout the tubular and glomerular compart-ments,paralleling the increase in␤-catenin mRNA expression(Figure2B).Glomerular staining was partic-ularly strong in proteinuric-stage mice.These findings suggest that the observed increase in Wnt/␤-catenin activ-ity occurs diffusely throughout the kidney.Immunostaining of cryosections gave no detectable signals for active ␤-catenin in BALB/c mice or10-week-old NZB/NZW mice,whereas diffuse intracellular staining was seen in 20-week-old NZB/NZW mice(Figure2C).Similarly, immunoblotting against the phosphorylated,inactive form of GSK3␤was increased in20-week-old NZB/NZW mice (Figure3C),with corresponding speckled intracytoplasmic immunostaining in cryosections from these mice(Figure 2D).Immunoblotting of nuclear protein extracts revealed increased expression of the active form of␤-catenin in 20-week-old NZB/NZW mice(Figure2A),further sup-porting activation of Wnt signaling in these mice.Table1.Expression of selected TCF/LEF-responsive genes*Mice Myc RhoU Foxn1Dvl2JunBALB/c 1.42Ϯ0.36 1.15Ϯ0.290.85Ϯ0.55 1.02Ϯ0.150.46Ϯ0.04(NZBϫNZW)F110weeks old 1.02Ϯ0.25 1.02Ϯ0.28 1.01Ϯ0.11 1.00Ϯ0.04 1.00Ϯ0.0820weeks old 1.48Ϯ0.26† 1.39Ϯ0.28† 1.65Ϯ0.45 1.31Ϯ0.14†0.83Ϯ0.18Proteinuric8.5Ϯ3.52† 5.19Ϯ1.21†18.38Ϯ10.3† 1.77Ϯ0.48† 2.81Ϯ1.65†*Values are the meanϮSEM fold change relative to the average expression level in10-week-old(NZBϫNZW)F1mice(nϭ5)after normalization for the expression level of TATA box binding protein withinthe same samples.The following forward primer and probe sequences were used:for Tbp,forwardAAGAAAGGGAGAATCATGGACC,probe CCTGAGCATAAGGTGGAAGGCTGTT,reverseGAGTAAGTCCTGTGCCGTAAG;for Myc,forward GCTGTTTGAAGGCTGGATTTC,probe CG-TAGTCGAGGTCATAGTTCCTGTTGGT,reverse GATGAAATAGGGCTGTACGGAG;for RhoU,forward CCCACCGAGTACATCCCTAC,probe ATGAGTTTGACAAGCTGAGGCCCC,reverseTGTCTGTGTTGGTGTAGCAG;for Foxn1,forward AAGAACAGTAAGACCGGAAGC,probe TTCT-GTTCGCCATAACCTGTCCCTC,reverse TCTCCACCTTCTCAAAGCAC;for Dvl2,forward TTTCAA-GAGCGTTTTGCAGC,probe TCCGATGACAATGCCCGCCTAC,reverse ACACAAGCCAGGAGA-CAAC;for Jun,forward TTGTTACAGAAGCAGGGACG,probe AGGCTAACCCCGCGTGAAGT,reverse GTCGTAGAAGGTCGTTTCCATC.TCF/LEFϭT cell factor/lymphocyte enhancement factor.†PϽ0.05versus BALB/c mice.516TVEITA AND REKVIGIncreased renal expression of Dkk-1during de-velopment of lupus nephritis.Dkk-1is a secreted in-hibitor of the canonical Wnt pathway and is known to be induced by canonical Wnt signaling (21),probably serving as a negative feedback mechanism.In line with our findings of increased expression of TCF/LEF-responsive genes,mRNA expression of Dkk-1in kidney homogenates increased beginning at 20weeks of age (Figure 3A).Immunofluorescence staining similarly revealed a strong increase in Dkk-1expression in both tubular and glomerular cells from NZB/NZW mice,in both the preproteinuric (20weeks old)and proteinuric groups compared to younger NZB/NZW mice,in which Dkk-1immunostaining was weaker,at levels comparable to those in BALB/c mice (Figure 3B).Western blotting revealed similar increases in Dkk-1expression in 20-week-old and proteinuric mice (Figure 3C).Wnt-inhibitory effects of lupus serum.The ob-served increase in renal Wnt/␤-catenin signaling could be caused by either intrinsic or circulating Wnt agonists.In order to evaluate the net influence of serum factors on canonical Wnt pathway activity,mesangial cells were exposed to serum from NZB/NZW mice andBALB/cFigure 2.Increased abundance of active (Act.)␤-catenin in NZB/NZW (B/W)mouse kidneys.A,Western blot analysis of nuclear protein extracts demonstrated increased amounts of the active (nonphosphorylated)form of ␤-catenin in 20-week-old and proteinuric-stage NZB/NZW mice compared to 10-week-old mice.␤-actin was used as a loading control.B–D,Immunofluorescence staining using an anti–␤-catenin antibody (B )and an antibody specific for the active,nonphosphorylated form of ␤-catenin (C )demonstrated increased amounts of ␤-actin immunostaining in 20-week-old and proteinuric-stage NZB/NZW mice compared to 10-week-old mice.Scattered,intracytoplasmic immunostaining against phosphor-ylated,inactive glycogen synthase kinase 3␤(pGSK3␤)was detectable in proteinuric-stage NZB/NZW mice but not in 10-week-old mice (D ).Images were obtained using identical exposure settings.Tot.ϭtotal.Original magnification ϫ200.Wnt PATHWAY AND Dkk-1IN SYSTEMIC LUPUS ERYTHEMATOSUS 517mice of different ages.Messenger RNA expression for the TCF/LEF-responsive genes Axin2and Ppard was as-sayed,revealing a dramatic decrease in the expression of these genes upon exposure to sera from 20-week-old and proteinuric-stage NZB/NZW mice compared to sera from 10-week-old mice (Figures 4A and B).This suggests that NZB/NZW mouse sera contain increased levels of Ն1Wnt inhibitors,and that the regulation of renal Wnt activity in lupus nephritis is not controlled by circulating factors.Based on our findings of increased expression of Dkk-1in the kidneys of NZB/NZW mice,Dkk-1levels in sera were determined by ELISA.Serum samples obtained from normal BALB/c mice showed stable concentrations in all age groups (data not shown).In NZB/NZW mice,Dkk-1was present at levels comparable to those in control BALB/c mice at age 10weeks (Figure 4C).In 20-week-old and proteinuric-stage NZB/NZW mice,there was a 5-fold increase in the serum level of Dkk-1compared to that in the younger mice (Figure 4C).Serial measurements of anti-dsDNA titers and serum Dkk-1revealed a significant increase in the concentration of Dkk-1at ϳ18weeks,with an apparent inverse correlation between the pattern of fluctuation in serum Dkk-1and the anti-dsDNA titer (Figure 4D).To evaluate whether these fluctuations in serum Dkk-1concentrations could be explained byautoantibodiesFigure 3.Dkk-1expression in mouse kidneys.A,Gene expression for Dkk-1in renal homogenates from NZB/NZW (B/W)mice and BALB/c mice (n ϭ5per age group)showed increased expression in 20-week-old and proteinuric-stage NZB/NZW mice.Expression levels were normalized against TATA box binding protein and expressed as the fold change values,using the ⌬⌬C t method.B,Immunofluorescence staining of kidney cryosections demonstrated a similar increase in Dkk-1immunostaining in 20-week-old and proteinuric-stage NZB/NZW mice as compared to that in prediseased 10-week-old mice.Immunostaining was increased within both the tubular and glomerular compartments.Images were obtained using identical exposure settings.Original magnification ϫ200.C,Western blotting against Dkk-1and the phosphorylated,inactivated form of GSK3␤(pGSK3␤)in renal protein homogenates demonstrated increased levels of Dkk-1and pGSK3␤in 20-week-old and proteinuric-stage NZB/NZW mice compared to those in 10-week-old NZB/NZW mice and BALB/c mice.␤-actin was used as a loading control.ءءϭP Ͻ0.01;ءءءϭP Ͻ0.001.518TVEITA AND REKVIGagainst Dkk-1,immunoblotting of sera against Dkk-1was performed under denaturing conditions,to reveal Dkk-1masked by autoantibodies.The results of these studies were consistent with the ELISA results,suggest-ing that the variations in serum Dkk-1concentrations are not explained by the presence of autoantibodies against this protein (data not shown).Proapoptotic effects of Dkk-1.Incubation of cul-tured primary mesangial cells with increasing concentra-tions of recombinant Dkk-1led to induction of apoptosis at concentrations comparable to those seen in serum from mice with lupus (12,000–20,000pg/ml),as evidenced by increased mRNA expression of the apoptosis-related genes casp3(Figure 5A)and Bax (data not shown).In contrast,expression of the apoptosis-inhibiting factor Bcl2remained relatively stable,as reflected by an in-creased Bax:Bcl2ratio at Dkk-1concentrations Ͼ10,000pg/ml (Figure 5B),which is considered to be a sign of induction of apoptosis in mesangial cells (22,23).Cell surface annexin V staining of mouse mes-angial and human proximal tubular cells after 24hours of incubation with Dkk-1showed a dramatically in-creased number of apoptotic cells in the Dkk-1con-centration range observed in sera from mice with lupus,with only a modest increase in apoptosis at concentrations comparable to those in BALB/c mouse sera (Figure 5C).These data indicate a strong pro-apoptotic effect of the increased circulating levels of Dkk-1observed in NZB/NZW mice during lupus devel-opment.Consistent with previous reports suggestive of proapoptotic effects of sera from patients with SLE (24),incubation of murine mesangial cells with sera from NZB/NZW mice caused an increased Bax:Bcl2ratio using sera from 20-week-old and nephritic-stage mice compared to younger mice (Figure 5D).Similar results were obtained using human proximal tubular cells (data notshown).Figure 4.Serum Dkk-1concentration (Conc.)and in vitro Wnt-inhibitory effects of serum obtained from mice with lupus.A and B,The expression of axin2(A )and Ppard (B )was determined in primary mouse mesangial cells following 6-hour incubation in the presence of serum (10%by volume)from NZB/NZW mice of various ages.Expression was decreased in cells exposed to serum from 20-week-old and proteinuric-stage NZB/NZW mice (n ϭ5per group)compared to that in cells exposed to serum from 10-week-old NZB/NZW mice.Expression levels were normalized against TATA box binding protein and expressed as the fold change,using the ⌬⌬C t method.C,Serum concentrations of Dkk-1,as determined by enzyme-linked immunosorbent assay,were significantly increased in 20-week-old and proteinuric-stage NZB/NZW mice compared to the concentrations in control BALB/c mice and 10-week-old NZB/NZW mice (n ϭ5per group).D,Serum titers of anti–double-stranded DNA (anti-dsDNA)autoantibodies and serum concentrations of Dkk-1were determined by serial sampling of NZB/NZW mice at different ages.Values are the mean ϮSEM.ءءϭP Ͻ0.01;ءءءϭP Ͻ0.001.O.D.ϭoptical density.Wnt PATHWAY AND Dkk-1IN SYSTEMIC LUPUS ERYTHEMATOSUS 519DISCUSSIONOur data show evidence of increased renal ex-pression of ␤-catenin and several TCF/LEF-responsive genes during the preproteinuric phase of the develop-ment of lupus nephritis in NZB/NZW mice,reflecting increased renal Wnt/␤-catenin signaling during disease progression.This suggests a role of canonical Wnt signaling in the development of nephritis and,based on recent results for other glomerulopathies (9),provides a potential mechanism to explain the extracellular mem-brane expansion that accompanies progression toward proteinuria and renal failure.Previous work by our group revealed an increase in the glomerular expression of MMP-2and MMP-9during the development of lupus nephritis (25),which was accompanied by qualitative changes in the composition of the type IV collagen matrix of the glomerular basement membrane.Interest-ingly,secretion of both MMP-2and MMP-9is induced by canonical Wnt signaling in T cells in vitro (26).Little is known about the effects of increased Wnt pathway activity on glomerular extracellular matrix synthesis,and this issue will need to be addressed by in vivo studies.Such studies are further warranted by recent data impli-cating increased ␤-catenin expression as a mediator of podocyte dysfunction and proteinuria in mice (9).Increased serum and renal levels of the Wntinhibitor Dkk-1paralleled the observed increase in re-nal canonical Wnt pathway activity.Dkk1is a Wnt-responsive gene in what is presumed to be a negative regulatory feedback mechanism of Wnt signaling (21).Although it is seemingly counterintuitive,increased lev-els of Dkk-1within the kidney could thus be seen asaFigure 5.In vitro induction of apoptosis by recombinant Dkk-1.A,The addition of recombinant Dkk-1to cultured primary mouse mesangial cells (n ϭ5per group)revealed increased mRNA expression levels of the proapoptotic caspase 3gene at high concentrations (Conc.)of Dkk-1(Ͼ10,000pg/ml)following 6-hour incubation.B,The mRNA expression ratio for Bax and Bcl-2was significantly increased at Dkk-1concentrations Ͼ10,000pg/ml after 6-hour incubation.C,Apoptosis was assayed using flow cytometry after fluorescence-based annexin V/propidium iodide staining,revealing an increased percentage of annexin V positivity in both murine mesangial cells and human proximal tubular epithelial cells after 24-hour incubation with Dkk-1in the concentration range seen in NZB/NZW mice (10,000–20,000pg/ml).All experiments were performed in triplicate.D,The mRNA expression ratio for Bax and Bcl-2following 6-hour incubation of mesangial cells (n ϭ5per group)with serum (20%by volume)from NZB/NZW mice (10weeks old,20weeks old,and proteinuric-stage)revealed an increased ratio at increasing ages.Values are the mean ϮSEM.ءϭP Ͻ0.05;ءءϭP Ͻ0.01;ءءءϭP Ͻ0.001.520TVEITA AND REKVIG。