Bromocriptine inhibits adipogenesis and lipogenesis by agonistic

Bromocriptine inhibits adipogenesis and lipogenesis by agonistic action on a 2-adrenergic receptor in 3T3-L1adipocyte cells
Rajib Mukherjee •Jong Won Yun
Received:5July 2012/Accepted:18December 2012/Published online:28December 2012ÓSpringer Science+Business Media Dordrecht 2012
Abstract The primary goals of the present study were to investigate the inhibitory effects of bromocriptine (BC)on adipogenesis and lipogenesis in 3T3-L1adipocyte cells as well as to elucidate its molecular mechanism of action.Adipogenic and lipogenic capacity of BC-treated cells was evaluated by oil red-O staining,triglyceride content assay,real-time RT-PCR"/>and immunoblotting.To determine the mechanism responsible for the anti-obesity effect of BC,we applied two methods.Firstly,we knocked down dopamine D2receptor (D2R)up to 50%using siRNA.Secondly,we blocked the activity of a 2-adrenergic receptor (a 2-AR)by yohimbine treatment and monitored its effects on adipogenic and lipogenic events in 3T3-L1cells.BC decreased the expression levels of adipogenic activators,including Ppar a ,Ppar c ,and Cebp a ,as well as major lipogenic target genes,including Me1,Acc1,6Pgd ,Fasn ,and Prkaa1.Moreover,BC markedly reduced intracellular nitric oxide formation in a dose-dependent manner and expression of pro-inflammatory genes,Tnf a and Il6,which reflects attenuated pro-inflammatory responses.Further,upon treatment with BC,D2R-deficient cells displayed a significant decrease in lipogenic activity compared to control cells,whereas yohimbine-treated cells exhibited no reduction in lipogenic activity.BC can effectively attenuate adipogenesis and lipogenesis in 3T3-L1cells by downregulating the expression of lipogenic genes and proteins.Our current experimental data collec-tively establish that the anti-obesity effects of BC are not D2R-dependent but result from the action of a 2-AR in 3T3-L1adipocytes.
Keywords Adrenergic receptor ÁBromocriptine ÁDopamine receptor ÁLipogenesis ÁObesity Á3T3-L1Abbreviations ACC Acyl CoA carboxylase
AMPK (Prka )AMP-activated protein kinase
(encoded gene)
AR Adrenergic receptor BC Bromocriptine C/ebp Gene encoding CCAAT/enhancer-binding
protein
DR Dopamine receptor FAS (Fasn )Fatty acid synthase (encoded gene)KD Knockdown Lep Leptin Il Gene encoding interleukin Me Malic enzyme NO Nitric oxide Pgd Gene encoding phosphogluconate
dehydrogenase
PPAR Peroxisome proliferator-activated
receptor
siRNA Small interference RNA Tnf Gene encoding tumor necrosis factor YB yohimbine
Introduction
Bromocriptine (2-bromo-a -ergocriptine,BC)is a potent ergot alkaloid derivate that acts as an agonist of hypotha-lamic dopamine D2receptor (D2R),which is used exten-sively to treat obesity [1–4],diabetes [5,6],and Parkinson’s disease [7].Ever since BC was recently approved by the
R.Mukherjee ÁJ.W.Yun (&)
Department of Biotechnology,Daegu University,Kyungsan,Kyungbuk 712-714,Republic of Korea e-mail:jwyun@daegu.ac.kr
Mol Biol Rep (2013)40:3783–3792DOI 10.1007/s11033-012-2455-5
FDA for the treatment of patients with type2diabetes[8],a growing number of studies have attempted to widen its applicability to other metabolic diseases[9–14].
A wealth of reports have demonstrated that the anti-obesity effects of BC are mediated by agonistic activation of D2R in the hypothalamus,a critical control center regulating food intake and energy homeostasis[1,5,6,8].Dopamine plays a key role in the brain system that is responsible for suppression of leptin expression and release of adiponectin, thereby leading to control of food intake[15].Therefore,its target receptors have received special attention,andfive different receptor types(DR1–5)have been identified to date [15,16].Although it isfirmly established that DRs are pre-dominantly expressed in the brain,recent studies have revealed that D2R is also present in adipocytes,suggesting the possibility of crosstalk between the brain and adipocytes for dopaminergic signaling pathways in the central regula-tory system[15,16].Interestingly,it was also reported that BC effectively modulates a2-adrenergic receptor(AR) activation as well as insulin secretion[17]and blood pressure [12].However,there has been no report demonstrating a2-AR-dependent regulation of lipogenesis by BC in adipo-cytes.Although it has been well demonstrated that BC reduces body weight of mammals by mimicking the activity of dopamine in the brain system,there is no considerable information concerning its effects on adipogenesis and lipogenesis in adipocytes[15,16].
The objectives of the present study were to investigate the inhibitory effects of BC on adipogenesis and lipogen-esis in3T3-L1adipocyte cells as well as to elucidate its underlying molecular mechanism of action.To this end,we performed comparative quantification of major adipogenic and lipogenic genes as well as pro-inflammatory genes expressed at the mRNA and protein levels in response to BC treatment.To determine the plausible mechanism responsible for the anti-obesity effects of BC,we applied two methods.Firstly,we knocked down dopamine D2 receptor(D2R)up to50%using siRNA.Secondly,we blocked the activity of a2-adrenergic receptor(a2-AR)by yohimbine treatment and monitored its effects on adipo-genic and lipogenic events in3T3-L1cells.Based on our results,we are able to report for thefirst time that BC greatly reduces adipogenesis and lipogenesis as well as obesity-related inflammation in3T3-L1adipocyte cells. Materials and methods
Cell culture and differentiation
Dulbecco’s Modified Eagle’s Medium(DMEM,Thermo, Waltham,MA,USA)supplemented with10%fetal bovine serum(FBS,PAA Laboratories,Pasching,Austria)and 100l g/ml of penicillin–streptomycin(Invitrogen,Carls-bad,CA,USA)were used to culture3T3-L1preadipocytes (ATCC,Manassas,VA,USA)at37°C in a5%CO2 incubator.Sufficiently confluent cells were maintained in differentiation induction medium consisting of10l g/ml of insulin(Sigma,St.Louis,MO,USA),0.25l M dexa-methasone(Sigma),and0.5mM3-isobutyl-1-methylxan-thine(IBMX,Sigma)in DMEM,followed by maturation medium containing10%FBS and10l g/ml insulin.Dur-ing treatments,cells were maintained in maturation med-ium containing(0–100l g/ml)of BC(Sigma)or10mM of yohimbine(Sigma)for6–8days before further analysis, and maturation medium was changed every2days.
Cytotoxicity assay
Cytotoxicity of BC was assessed by MTT(30-(4,5-dimeth-ylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide)(Generay Biotech,Shanghai,China)assay based on the reduction of MTT into formazan dye by active mitochondria.Briefly, 59104cells/ml were cultured in DMEM containing10% FBS in a96-well plate at37°C under5%CO2atmosphere for24h,followed by exchange with medium containing different concentrations of BC(10,25,50,70,and100l g/ ml).Then,20l l of MTT solution(5mg MTT/ml in PBS) was added to each well of the microtiter plate,which was incubated for4h.After washing,formazan dye formed only by living cells was dissolved in100l l of dimethyl sulfoxide (DMSO).Absorbance was measured at540nm using a microtiter plate reader.
Oil red-O staining
Control and BC-treated cells matured for4–6days were washed with phosphate-buffered saline(PBS),fixed with 10%formalin for1h at room temperature,and washed three times with deionized water.A mixture of oil red-O (0.6%oil red-O dye in isopropanol)and water at a6:4 ratio was layered on the cells for10min,followed by washing three times with deionized water and photography. Intercellular oil red-O stain was photometrically measured by dissolving the stain for10min in60%isopropanol. Quantification of triglyceride(TG)
Control and BC-treated cells matured for4–6days were washed twice with PBS and harvested in order to prepare cell lysate using RIPA buffer(Sigma).TG content was measured according to the manufacturer’s instructions using a TG test kit(Asan Pharm.Co.,Yeongcheon,Korea). Absorbance was measured at550nm,and TG content was normalized to protein content as determined by the Brad-ford method[18].
Quantification of intracellular nitric oxide(NO) Intracellular concentration of NO was quantified using Griess reaction,and the calculated concentration was used as an indicator of NO production[19].Control and BC-treated cells were homogenized in PBS,after which100l l of cell lysate was mixed with100l l of Griess reagent(1% sulfanilamide in5%phosphoric acid and0.1%naphthy-lethylenediamine dihydrochloride in water),followed by incubation in the dark for10min.Finally,the absorbance was measured at540nm using an automated microtiter plate reader(Thermo Electron Corp.,Waltham,MA,USA) and plotted on a sodium nitrate standard curve to quantify the nitrite concentration.
Quantitative real-time RT-PCR
Cells matured for4–6days were harvested,after which total RNA was isolated using a total RNA isolation kit (RNA-spin,iNtRON Biotechnology,Seongnam,Korea) and1l g of RNA was converted to cDNA using Maxime RT premix(iNtRON Biotechnology).Transcript levels of genes were quantitatively determined by employing Power SYBR Green(GE Healthcare,Warrington,UK)with real-time RT-PCR(Stratagene246mx3000p QPCR System, Agilent Technologies,Santa Clara,CA,USA).Transcript levels of each gene were normalized to the level of b-actin. Sequences of primer sets used in this study are listed in Table1.
Knockdown of dopamine D2receptor(D2R)using siRNA
Commercially available siRNA specific for D2R(a pool of three target-specific20–25nucleotide siRNAs designed to knockdown gene expression,Santa Cruz Biotechnology Inc.,Santa Cruz,CA,USA)was used for gene silencing in 3T3-L1cells.Postconfluent3T3-L1cells in6-well culture dishes were washed twice with transfection medium and overlaid with a previously made mixture of siRNA and transfection reagent(Santa Cruz Biotechnology).The transfection process was carried out for5–7h,followed by the addition of differentiation medium.After completion of differentiation,cells were maintained in maturation med-ium with or without BC for4–6days.Transfection effi-ciency was monitored by estimating the uptake of non-targetingfluorescein-labeled double-stranded RNA oligo-mers(BLOCK-iT,150nM per well,#2013,Invitrogen). Transcript levels of each gene were normalized to the level of b-actin.Finally,knockdown efficiency of transiently siRNA-expressing cells was determined as follows:%Knockdown¼aÀb
ðÞ=b x100
a Normalized expression level of each gene in siRNA-
transfected cells
b Normalized expression level of each gene in BLOCK-
iT-transfected cells
.
Immunoblot analysis
Cell lysates were prepared using RIPA buffer(Sigma)by homogenization and centrifugation at14,0009g for 20min.Cell extract was diluted in59sample buffer (50mM Tris of pH6.8,2%SDS,10%glycerol,5%b-mercaptoethanol,and0.1%bromophenol blue)and heated for5min at95°C before SDS-polyacrylamide gel elec-trophoresis(PAGE)using8,10,or12%acrylamide gel. Table1Sequences of primers used in real-time RT-PCR
Genes Primer sequence(50–30)
Ppar c F a GGTGAAACTCTGGGAGATTC
R b CAACCATTGGGTCAGCTCTT
C/ebp a F AGGTGCTGGAGTTGACCAGT
R CAGCCTAGAGATCCAGCGAC Ppar a F CCCCACCAGTACAGATGAGTC
R GGAGTTTTGGGAAGAGAAAGG Me1F AGAGCTCTCGTTCCCAAACA
R TTGTCTCAGAGGTGGGTTCC Fasn F CCTTAGAGGCAGTGCAGGAC
R TTGCTGCACTTCTTGGACAC
Acc1F GAGAGGGGTCAAGTCCTTCC
R ACATCCACTTCCACACACGA Prkaa1F CAGGCCATAAAGTGCAGTTA
R AAAAGTCTGTCGGAGTGCTGA
6Pgd F TGAAGGGTCCTAAGGTGGTCC
R CCGCCATAATTGAGGGTCCAG Lep F TTTCACACACGCAGTCGGTAT
R GGTCTGGTCCATCTTGGACAA
Tnf a F AGGCCTTGTGTTGTGTTTCCA
R TGGGGGACAGCTTCCTTCTT
Il6F ACAACCACGGCCTTCCCTACTT
R CACGATTTCCCAGAGAACATGTG D2r F TATGCCCTGGGTCGTCTATC
R AGGACAGGACCCGACAATG Internal control
b-Actin F AGCCATGTACGTAGCCATCC
R CTCTCAGCTGTGGTGGTGAA
a F sequence from sense strands
b R sequence from anti-sense strands
After electrophoresis,samples were transferred to a poly-vinylidene difluoride membrane(PVDF,Santa Cruz Bio-technology)and then blocked for1h with TBS(Tris-buffered saline)-T buffer(10mM Tris-HCl,150mM NaCl,and0.1%Tween20containing5%skim milk). The membrane was rinsed three times consecutively with TBS-T buffer,followed by incubation for1h with1:1,000 dilutions of the primary monoclonal antibodies anti-b-actin,anti-PPAR c,anti-AMPK,and anti-pAMPK(Santa Cruz Biotechnology)as well as anti-FAS,anti-ACC,and anti-pACC(Cell Signaling Technology,Beverly,MA, USA)in TBS-T buffer containing1%skim milk.After three washes,the membrane was incubated for1h with horseradish peroxidase-conjugated anti-goat IgG or anti-rabbit IgG secondary antibody(1:1,000,AB Frontier, Seoul,Korea)in TBS-T buffer containing1%skim milk. Development was carried out using enhanced chemilumi-nescence(West Zol,iNtRON Biotechnology).Band intensities were quantified using ImageMaster(GE Healthcare,Little Chalfont,Buckinghamshire,UK). Inhibition of a2-adrenergic receptor(a2-AR)
To determine whether or not BC acts through a2-AR in 3T3-L1adipocytes,we blocked a2-AR activity using yohimbine,a potent a2-AR inhibitor.For this,we used 0.1mM yohimbine,followed by BC treatment in the beginning of the maturation period.To demonstrate the effect of yohimbine treatment in3T3-L1cells,we measured lipid droplet formation by oil red-O staining as well as intracellular TG content.
Statistical analysis
All data expressed as the mean±SD were compared by one-way analysis of variance(ANOVA)using the Statis-tical Package of Social Science(SPSS,version14.0K) program.Student’s t test was also used for data comparison in the case of two experimental groups.Group means were considered significantly different at p\0.05,as deter-mined by the technique of protected least-significant dif-ference(LSD)when ANOVA indicated an overall significant treatment effect(p\0.05).
Results
Anti-lipogenic,cytotoxicity,and anti-adipogenic
effects of BC in3T3-L1cells
Treatment of3T3-L1cells with BC reduced TG content in a dose-dependent manner,providing evidence of the anti-lipogenic activity of BC(Fig.1A).The most effective treatment concentration of BC was determined to be50l g/ ml,and thus this concentration was used for all subsequent experiments.Quantitative measurement of the intracellular amount of oil droplets using oil red-O staining revealed
BC (50µg/ml)
Control
that BC-treated (50l g/ml)cells contained 70–80%less oil droplets compared to control cells (Fig.1B).
Consequently,we measured the cytotoxicity of BC against 3T3-L1cells.As shown in Fig.2A,BC displayed no significant cytotoxicity at concentrations of 10–100l g/ml for treatment periods of 24and 48h.Next,to examine the inhibitory effects of BC on adipogenesis in 3T3-L1cells,the expression levels of major adipogenic transcrip-tional factors,including Ppar c ,Cebp a ,and Ppar a ,were compared before and after BC treatment.Higher than 50%reduction in the expression of these factors was observed in BC-treated cells compared to control cells (Fig.2B),sug-gesting that BC inhibited adipogenesis in 3T3-L1cells through activation of these transcriptional factors.<Dummy RefID="F_11033_2012_2455_Fig2_HTML BC suppresses expression of lipogenic and pro-inflammatory genes in 3T3-L1cells
To determine the genetic basis of the anti-lipogenic activity of BC,we treated 3T3-L1cells with 50l g/ml of BC for 6days followed by quantification of the expression levels of major lipogenic genes.As shown in Fig.3A (gray bars),our real-time PCR data show that BC-treated cells dis-played strikingly lower expression levels of major lipo-genic target genes such as Me1,Fasn ,Acc1,Prkaa1,6Pgd ,
and Lep .Next,we investigated pro-inflammatory responses upon BC treatment due to the fact that obesity is followed by pro-inflammatory responses in adipocytes [20,21].To this end,we first quantified intracellular concentrations of nitric oxide (NO),which is an inflammatory marker in numerous types of cells [22].As shown in Fig.3B,BC treatment markedly reduced NO formation in a dose-dependent manner,implying attenuated pro-inflammatory responses in BC-treated cells.This result was in line with the reduced expression of two major pro-inflammatory genes,Tnf a and Il6(white bars in Fig.3A).
To firmly confirm our genomic data,we also measured the expression levels of several lipogenic proteins,including PPAR c ,FAS,AMPK1,pAMPK1,ACC,and pACC.Expectedly,BC treatment reduced the expression levels of all major lipogenic proteins examined but increased those of pACC and pAMPK1,thereby demon-strating reduced lipogenesis (Fig.4).
Molecular mechanism responsible for reduced lipogenesis in 3T3-L1adipocytes
Our study attempted to determine exactly which molecular pathway is linked to the anti-adipogenic and anti-lipogenic activities of BC in adipocytes.To clarify this issue,we firstly investigated whether or not BC acts as a D2R agonist in 3T3-L1cells,similar to its action in the brain.For this,we made D2R-deficient cells (50%knocked down)using commer-cially available siRNA and monitored the agonistic effect of BC on lipogenesis in those cells (Fig.5A).To our surprise,D2R-deficient cells exhibited similar lipogenic capacity as control cells.Further,no significant difference in the forma-tion of lipid oil droplets was detected between D2R-deficient and control cells.However,upon treatment with BC,D2R-deficient cells showed 70–80%less oil droplet formation (Fig.5B,C)as well as lower TG content (Fig.5D).These results led us to hypothesize that other mechanisms are responsible for the anti-lipogenic activity of BC.
Next,in order to establish that BC is functionally associated with a 2-AR,especially in the context of its anti-lipogenic effect,we used the a 2-AR inhibitor yohimbine to specifically block a 2-AR activity.For this,the anti-lipo-genic activity of BC was monitored using oil red-O stain-ing and TG content assay.The results show that the anti-lipogenic activity of BC (oil droplet formation and TG content)was attenuated in 3T3-L1cells pretreated with yohimbine prior to BC (Fig.6),implying that BC has an agonistic effect on a 2-AR in 3T3-L1adipocytes.
Discussion
In the present study,we demonstrated the anti-adipogenic and anti-lipogenic effects of BC,as evidenced by reduced lipid droplet formation and TG content as well as the decreased expression of genes involved in adipogenesis and lipogenesis in 3T3-L1adipocytes.Moreover,we were able to elucidate the molecular mechanism underlying the anti-obesity activity of BC in 3T3-L1adipocytes.
It was previously reported by Cincotta et al.[3]that D2R agonists markedly reduce body fat mass,hypergly-cemia,and hyperlipidemia.Specifically,treatment with D2R agonists has been shown to prevent the onset of obesity by regulating energy homeostasis [17].Further,many investigators have reported that BC has beneficial effects on obesity and obesity-related diseases in animal models through the regulation of feeding behavior [1,2,11,23].Although BC is a well established D2R agonist,it has been shown that BC acts on other G-protein coupled receptors such as a 2-AR [17]and similar receptors [24].Specifically,BC activates postsynaptic dopamine receptors that regulate feeding behavior,thereby reducing food intake in mammals [25].However,the anti-obesity effect of BC is a combination of reduced feeding,increased energy expenditure,and decreased lipogenesis [1,3,4,11].To date,the molecular mechanism underlying the anti-obesity activity of BC as well as its connection with obesity-related pro-inflammatory responses remain to be explained.Further,there have been no in vitro studies using
adipocyte
Fig.4Effect of bromocriptine (BC)on expression of major lipogenic proteins in 3T3-L1cells.Data are representative of three independent assays.Statistical significance between each group was determined by one-way ANOVA test,where *p \0.05and **p \0.01
cells to investigate the molecular action of BC in relation to obesity.To the best of our knowledge,this is thefirst report to investigate the anti-lipogenic and anti-adipogenic effects of BC as well as its anti-inflammatory properties in3T3-L1 cells.
To elucidate the connection between BC and both adipo-genesis and lipogenesis,we confirmed that BC significantly reduced the expression of key adipogenic transcriptional activators such as Ppar c,C/ebp a,and Ppar a as well as adi-pogenic regulatory factors such as Lep[26,27].Next,the anti-lipogenic activity of BC was verified,as the expression of genes associated with lipogenesis,including Me1,Fasn,Acc1, Prkaa1,and6Pgd,was remarkably reduced at both the tran-script and protein levels.Based on these data,we propose that BC controls major lipogenic target genes in an adipogenic transcriptional activator-dependent manner.
We further demonstrated that AMPK1and pAMPK1are present at different concentrations between control and BC-treated cells.In detail,BC-treated cells showed higher expression of pAMPK1,which can effectively attenuate fat synthesis via the ACC-FAS pathway.On the other hand,lower expression of AMPK1suggests that BC-treated cells were in a negative energy state in which anabolic pathways are swit-ched off[28].Specifically,a lower AMPK1level may speed up the consumption of carbohydrates,thereby decreasing the rates of lipogenesis and fatty acid uptake while increasing the rate of b-oxidation[29].Thus,BC can alter the regulation of upstream signaling pathways as well as the ATP/AMP ratio, resulting in increased conversion of AMPK1to pAMPK1. Further,a higher concentration of p-ACC in BC-treated cells was indicative of lower lipogenic capacity.
Importantly,we observed an inverse relationship between BC and obesity-associated pro-inflammatory responses in 3T3-L1cells.Tnf a and Il6are major pro-inflammatory genes [30,31],whereas nitric oxide(NO)is regarded as a pro-inflammatory marker[22].In earlier studies,it was found that Tnf a and Il6knockout mice display stimulated devel-opment of obesity-induced insulin resistance[32,33],and obesity is always followed by acute inflammatory responses [34].Here,we found that BC effectively reduced NO for-mation as well as expression of Tnf a and Il6.Therefore,our datafirmly show that BC not only blocked lipogenesis but
D2DR KD + BC
D2DR KD
Control
also attenuated obesity-related pro-inflammatory responses in3T3-L1cells.Further,as earlier reports have demonstrated that obesity-related inflammation is the predominant cause of type2diabetes[35,36],and BC has been shown to greatly reduce insulin insensitivity in animal models and humans [37,38],we hypothesize that the obesity-related anti-inflammatory effect of BC may be intimately connected with its anti-diabetic properties.Additional studies should be carried out to directly test this hypothesis.
Apart from its D2R agonistic activity,BC acts as a strong a1-AR antagonist and a2-AR agonist in the brain system[2,17,39].Here,we observed that BC had a very similar anti-lipogenic effect even after D2R knockdown;so significant differences were detected in the formation of oil droplets or TG in D2R KD cells.Taken together,this result clearly indicates that the D2R agonistic activity of BC was not responsible for the reduced lipogenesis in3T3-L1cells. Therefore,we propose that BC activated an adjacent molecular pathway through another receptor type,thereby leading to reduced lipogenesis in3T3-L1cells.In support of this,a recent report demonstrated that BC acts through a2-AR to inhibit insulin secretion in INS-1E cells[17]. Similarly,we tested whether or not a2-AR is involved in the differential regulation of lipogenesis.For this,we blocked a2-AR using the inhibitor yohimbine,which resulted in the loss of anti-lipogenic activity of BC in3T3-L1cells.Therefore,we assert that BC mediated its anti-lipogenic effects in3T3-L1cells through a2-AR.Conclusion
We report herein for thefirst time that BC has great potential to negatively regulate the expression of major adipogenic and lipogenic genes as well as pro-inflamma-tory maker molecules that are responsible for inhibiting obesity along with other metabolic syndromes.We also were able to elucidate the mechanism responsible for the anti-obesity effect of BC through two mechanistic tech-niques,knockdown of D2R gene and inhibition of a2-AR activity.Our data collectively establish that the anti-obesity effect of BC in3T3-L1adipocytes is not D2R-dependent but results from the action of a2-AR.
Acknowledgments This work was supported by a Daegu University Research Grant2012.
References
1.Cincotta AH,Meier AH(1989)Reductions of body fat stores and
total plasma cholesterol and triglyceride concentrations in several species by bromocriptine treatment.Life Sci45(23):2247–2254 2.Cincotta AH,MacEachern TA,Meier AH(1993)Bromocriptine
redirects metabolism and prevents seasonal onset of obese hype-rinsulinemic state in Syrian hamsters.Am J Physiol264(2Pt1): E285–E293
3.Cincotta AH,Tozzo E,Scislowski PW(1997)Bromocriptine/
SKF38393treatment ameliorates obesity and associated metabolic dysfunctions in obese(ob/ob)mice.Life Sci61(10):951–956
A
BC
Control
YB
4.Janssen GB,Beems RB,Elvers LH,Speijers GJ(2000)Subacute
toxicity of alpha-ergocryptine in Sprague-Dawley rats.2:meta-bolic and hormonal changes.Food Chem Toxicol38(8):689–695 5.Barnett AH,Chapman C,Gailer K,Hayter CJ(1980)Effect of
bromocriptine on maturity onset diabetes.Postgrad Med J56(651): 11–14
6.Cincotta AH,Meier AH,Cincotta M Jr(1999)Bromocriptine
improves glycaemic control and serum lipid profile in obese Type 2diabetic subjects:a new approach in the treatment of diabetes.
Expert Opin Investig Drugs8(10):1683–1707.doi:10.1517/1354 3784.8.10.1683
7.Yoshikawa T,Minamiyama Y,Naito Y,Kondo M(1994)Anti-
oxidant properties of bromocriptine,a dopamine agonist.J Neu-rochem62(3):1034–1038
8.Grant P(2011)Improving perioperative diabetes care.Clin Med
11(3):298
9.Kok P,Roelfsema F,Frolich M,van Pelt J,Stokkel MP,Meinders
AE,Pijl H(2006)Activation of dopamine D2receptors simul-taneously ameliorates various metabolic features of obese women.Am J Physiol Endocrinol Metab291(5):E1038–E1043.
doi:10.1152/ajpendo.00567.2005
10.Davis LM,Pei Z,Trush MA,Cheskin LJ,Contoreggi C,McCul-
lough K,Watkins PA,Moran TH(2006)Bromocriptine reduces steatosis in obese rodent models.J Hepatol45(3):439–444.doi:
10.1016/j.jhep.2006.03.019
11.Davis LM,Michaelides M,Cheskin LJ,Moran TH,Aja S,
Watkins PA,Pei Z,Contoreggi C,McCullough K,Hope B,Wang GJ,Volkow ND,Thanos PK(2009)Bromocriptine administra-tion reduces hyperphagia and adiposity and differentially affects dopamine D2receptor and transporter binding in leptin-receptor-deficient Zucker rats and rats with diet-induced obesity.Neuro-endocrinology89(2):152–162.doi:10.1159/000170586
12.Pijl H,Ohashi S,Matsuda M,Miyazaki Y,Mahankali A,Kumar
V,Pipek R,Iozzo P,Lancaster JL,Cincotta AH,DeFronzo RA (2000)Bromocriptine:a novel approach to the treatment of type2 diabetes.Diabetes Care23(8):1154–1161
13.Via MA,Chandra H,Araki T,Potenza MV,Skamagas M(2010)
Bromocriptine approved as thefirst medication to target dopa-mine activity to improve glycemic control in patients with type2 diabetes.Diabetes Metab Syndr Obes3:43–48
14.Defronzo RA(2011)Bromocriptine:a sympatholytic,d2-dopa-
mine agonist for the treatment of type2diabetes.Diabetes Care 34(4):789–794.doi:10.2337/dc11-0064
15.Borcherding DC,Hugo ER,Idelman G,De Silva A,Richtand
NW,Loftus J,Ben-Jonathan N(2011)Dopamine receptors in human adipocytes:expression and functions.PLoS ONE 6(9):e25537.doi:10.1371/journal.pone.0025537
16.Pasqualini C,Weltzien FA,Vidal B,Baloche S,Rouget C,Gilles
N,Servent D,Vernier P,Dufour S(2009)Two distinct dopamine D2receptor genes in the European eel:molecular characteriza-tion,tissue-specific transcription,and regulation by sex steroids.
Endocrinology150(3):1377–1392.doi:10.1210/en.2008-0578 17.de Leeuw van Weenen JE,Parlevliet ET,Maechler P,Havekes
LM,Romijn JA,Ouwens DM,Pijl H,Guigas B(2010)The dopamine receptor D2agonist bromocriptine inhibits glucose-stimulated insulin secretion by direct activation of the alpha2-adrenergic receptors in beta cells.Biochem Pharmacol79
(12):1827–1836.doi:10.1016/j.bcp.2010.01.029
18.Bradford MM(1976)A rapid and sensitive method for the
quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.Anal Biochem72:248–254 19.Guevara I,Iwanejko J,Dembinska-Kiec A,Pankiewicz J,Wanat A,
Anna P,Golabek I,Bartus S,Malczewska-Malec M,Szczudlik A (1998)Determination of nitrite/nitrate in human biological material by the simple Griess reaction.Clin Chim Acta274(2):177–18820.Shoelson SE,Herrero L,Naaz A(2007)Obesity,inflammation,
and insulin resistance.Gastroenterology132(6):2169–2180.doi:
10.1053/j.gastro.2007.03.059
21.Wellen KE,Hotamisligil GS(2003)Obesity-induced inflamma-
tory changes in adipose tissue.J Clin Invest112(12):1785–1788.
doi:10.1172/JCI20514
22.Cirino G,Distrutti E,Wallace JL(2006)Nitric oxide and
inflammation.Inflamm Allergy Drug Targets5(2):115–119 23.Scislowski PW,Tozzo E,Zhang Y,Phaneuf S,Prevelige R,
Cincotta AH(1999)Biochemical mechanisms responsible for the attenuation of diabetic and obese conditions in ob/ob mice treated with dopaminergic agonists.Int J Obes Relat Metab Disord 23(4):425–431
24.Carson MJ,Thomas EA,Danielson PE,Sutcliffe JG(1996)The
5HT5A serotonin receptor is expressed predominantly by astro-cytes in which it inhibits cAMP accumulation:a mechanism for neuronal suppression of reactive astrocytes.Glia17(4):317–326.
doi:10.1002/(SICI)1098-1136(199608)17:4\317:AID-GLIA6[
3.0.CO;2-W
25.Agurs-Collins T,Fuemmeler BF(2011)Dopamine polymor-
phisms and depressive symptoms predict foods intake.Results from a nationally representative sample.Appetite57(2):339–348.
doi:10.1016/j.appet.2011.05.325
26.Gregoire FM,Smas CM,Sul HS(1998)Understanding adipocyte
differentiation.Physiol Rev78(3):783–809
27.Fajas L,Auboeuf D,Raspe E,Schoonjans K,Lefebvre AM,
Saladin R,Najib J,Laville M,Fruchart JC,Deeb S,Vidal-Puig A, Flier J,Briggs MR,Staels B,Vidal H,Auwerx J(1997)The organization,promoter analysis,and expression of the human PPARgamma gene.J Biol Chem272(30):18779–18789
28.Daval M,Foufelle F,Ferre P(2006)Functions of AMP-activated
protein kinase in adipose tissue.J Physiol574(Pt1):55–62.doi:
10.1113/jphysiol.2006.111484
29.Kola B,Grossman AB,Korbonits M(2008)The role of AMP-
activated protein kinase in obesity.Front Horm Res36:198–211.
doi:10.1159/0000115366
30.Hotamisligil GS,Spiegelman BM(1994)Tumor necrosis factor
alpha:a key component of the obesity-diabetes link.Diabetes 43(11):1271–1278
31.Lee YH,Pratley RE(2005)The evolving role of inflammation in
obesity and the metabolic syndrome.Curr Diabetes Rep5(1): 70–75
32.Uysal KT,Wiesbrock SM,Marino MW,Hotamisligil GS(1997)
Protection from obesity-induced insulin resistance in mice lack-ing TNF-alpha function.Nature389(6651):610–614.doi:
10.1038/39335
33.Di Gregorio GB,Hensley L,Lu T,Ranganathan G,Kern PA
(2004)Lipid and carbohydrate metabolism in mice with a tar-geted mutation in the IL-6gene:absence of development of age-related obesity.Am J Physiol Endocrinol Metab287(1):E182–E187.doi:10.1152/ajpendo.00189.2003
34.Rocha VZ,Folco EJ(2011)Inflammatory concepts of obesity.Int
J Inflamm2011:529061.doi:10.4061/2011/529061
35.Duncan BB,Schmidt MI,Pankow JS,Ballantyne CM,Couper D,
Vigo A,Hoogeveen R,Folsom AR,Heiss G(2003)Low-grade systemic inflammation and the development of type2diabetes: the atherosclerosis risk in communities study.Diabetes52(7): 1799–1805
36.Schmidt MI,Duncan BB,Sharrett AR,Lindberg G,Savage PJ,
Offenbacher S,Azambuja MI,Tracy RP,Heiss G(1999)Markers of inflammation and prediction of diabetes mellitus in adults (Atherosclerosis Risk in Communities study):a cohort study.
Lancet353(9165):1649–1652
37.Liang Y,Lubkin M,Sheng H,Scislowski PW,Cincotta AH
(1998)Dopamine agonist treatment ameliorates hyperglycemia,。