线虫鉴定通用引物

The primer pairs used were D2A (5’-acaagtaccgtgagggaaagttg-3’) and D2B(5’-aatccgtgtttcaagacggg-3’), D3A (5’-gacccgtcttgaaacacgga-3’) and D3B(5’-tcggaaggaaccagctacta- 3’) (Nunn, 1992), and mtA (5’-ggcggatcctacatcgatgttgtat-3’) and mtB (5’-ggcggatccwkttcctctcgtact-3’). These primers selectively amplify metazoan ribosomal DNAs (rDNA) and do not amplify common contaminants such as bacteria, fungi, or plant material. Courtright EM, Wall DH, Virginia RA, et al. Nuclear and mitochondrial DNA sequence diversity in the Antarctic nematode Scottnema lindsayae. Journal of Nematology, 2000, 32(2): 143.DNA extraction and polymerase chain reaction (PCR) assays were performed according to Subbotin et al. (2000). The ITS1-5.8S-ITS2 and the D2-D3 of 28S of rDNA were amplified using the following primer sets: 5367 (5’-ttgattacgtccctgcccttt-3’) and F195 (5’-tcctccgctaaatgatatg-3’); and D2A (5’-acaagtaccgtgagggaaagttg-3’) and D3B (5’-tcggaaggaaccagctacta-3’) as described by Schmitz et al. (1998) and De Ley et al. (1999), respectively.Castillo P, Vovlas N, Subbotin S, et al. A new root-knot nematode, Meloidogyne baetica n.sp.(Nematoda: Heteroderidae), parasitizing wild olive in Southern Spain. Phytopathology, 2003, 93(9): 1093-1102.D3A(5’-gacccgtcttgaaacacgga-3’) and D3B (5’-tcggaaggaaccagctacta-3’).Al-Banna L, Ploeg A T, Williamson V M, et al. Discrimination of six Pratylenchus species using PCR and species-specific primers. Journal of nematology, 2004, 36(2): 142.The nuclear ribosomal internal transcribed spacer (ITS1) segment was amplified with the primers rDNA2 5’-ttgattacgtccctgcccttt-3’ (Vrain et al. 1992) and rDNA1.58S5’-acgagccgagtgatccaccg-3’ (Cherry et al. 1997). The ribosomal LSU D2-D3 expansion segment was amplified with primersD2A 5’-acaagtaccgtgagggaaagttg-3’ and D3B5’-tcggaaggaaccagctacta-3’ (Courtright et al.,2000) as previously described (Al-Banna et al., 1997).Skantar AM, Carta LK. Multiple displacement amplification (MDA) of total genomic DNA from Meloidogyne spp. and comparison to crude DNA extracts in PCR of ITS1, 28S D2-D3 rDNA and Hsp90. Nematology, 2005, 7(2): 285-294.Several nematode specimens of each sample were transferred to an Eppendorf tube containing 16 ul ddH2O, 2 ul 10X PCR buffer and 2 ul proteinase K (600 ug/ml) (Promega, Benelux, The Netherlands) and crushed for 2 min with a Vibro Mixer microhomogeniser (Zürich, Switzerland). The tubes were incubated at 65ºC (1 h) and then at 95◦C (15 min). Detailed protocols for PCR, cloning and automated sequencing are described by Tanha Maafi et al. (2003). The forward D2A (5’-acaagtaccgtgagggaaagttg-3’) and reverse D3B (5’-tcggaaggaaccagctacta-3’) primers were used for amplification and sequencing of the fragment of the 28S rRNA gene.Subbotin SA, Vovlas N, Crozzoli R, et al. Phylogeny of Criconematina Siddiqi, 1980 (Nematoda: Tylenchida) based on morphology and D2-D3 expansion segments of the 28S-rRNA gene sequences with application of a secondary structure model. Nematology, 2005, 7(6): 927-944.The different regions of rDNA were amplified as described by Castillo et al.(2003) and Tigano et al. (2005) using the following primer sets:MelF (5’-tacggactgagataatggt-3’) and MelR(5’-ggttcaagccactgcga-3’) for the 18S, 5367 (5’-ttgattacgtccctgcccttt-3’) and F195(5’-tcctccgctaaatgatatg-3’) for the ITS1–5.8S-ITS2, D2A (5’- acaagtaccgtgagggaaagttg-3’) andD3B (5’-tcggaaggaaccagctacta-3’) for the D2-D3 region of 28S.Rius JEP, Vovlas N, Troccoli A, et al. A new root-knot nematode parasitizing sea rocket from Spanish Mediterranean coastal dunes: Meloidogyne dunensis n. sp. (Nematoda: Meloidogynidae). Journal of nematology, 2007, 39(2): 190.Cloning, characterisation and heterologous expression of an astacin metalloprotease, Sc-AST, from the entomoparasitic nematode Steinernema carpocapsaeY Jing, D Toubarro, Y Hao, N Simões - Molecular and biochemical …, 2010 - Elsevier... Total RNA from different nematode stages and from nematodes induced for 0, 6, 12, 24, 36, 48and 72 h was ...Primers for 18S rRNA were 18SF(5′-GCTAATCGGAAACGAAAGTC-3′) and18SR (5′-CATCCACCGAATCAAGAAAG-3′).Primers for Sc-AST were ASTF1 (5 ...5.8SF194/F195: Tm55℃TW81/AB28:18S:Me1f/Me1r: Tm 50℃18SF/18SR:28S:D2A/D3B: Tm 55℃mtDNAC2F3/1108: Tm 50℃C2F3/MRH106: Tm 50℃Incorporating molecular identification of Meloidogyne spp. into a large-scale regional nematode surveyTO Powers, PG Mullin, TS Harris, LA Sutton… - Journal of …, 2005 - ... For M. chitwoodi identification, the first of two PCR amplifications was conducted with primer set C2F3/ 1108 (5 GGTCAATGTTCAGAAATTTGTGG 3 and 5 TACCTTTGACCAATCACGCT 3) located in the COII and 16S ribosomal mitochondrial genes, respectively (Powers and ..Biometrical, biochemical, and molecular diagnosis of Portuguese Meloidogyne hispanica isolatesCM Maleita, MJ Simões, C Egas, RHC Curtis… - Plant …, 2012 - Am Phytopath Society... Mitochondrial DNA from isolates PtHi3 of M. his- panica and ItE of M. ethiopica were sequenced with the primer set C2F3(5′-GGT CAA TGT TCA GAA ATT TGT GG-3′) and MRH106(5′-AAT TTC TAA AGA CTT TTC TTA GT-3′) located in the COII gene and the 16S rRNA... [PDF]Prevalence, incidence and molecular identification of root-knot nematodes of tomato in PakistanM Ahmed - African Journal of Biotechnology, 2012 - ... DNA amplification of mtDNA with C2F3/1108 primers yielded a 1700 bp size productfor all three species of RKNs in comparison with 520 and 750 bp for M. chitwoodiand enterolobii, respectively, which were utilized as control.Plant-parasitic nematodes in sugarcane fields in Kitadaito Island (Okinawa), Japan, as a potential sugarcane growth inhibitorM Kawanobe, N Miyamaru, K Yoshida… - …, 2014 - ...Nematode identification using DNA sequence data Single nematodes were handpicked using a sterilised needle, rinsed with distilled water and placed on a glass slide. ...F194 (5-CGTAACAAGGTAGCTGTAG- 3 ) and F195 (5 -TCC TCC GCT AAA TGA TAT G-3 ) wereDetection of the pinewood nematode, Bursaphelenchus xylophilus, using a real-time polymerase chain reaction assayAX Cao, XZ Liu, SF Zhu, BS Lu - Phytopathology, 2005 - Am Phytopath Society... One to four nematodes were placed into 15 µl of double-distilled water on ... sterile 0.5-ml thin- walled PCR tube containing 8 µl of nematode lysis buffer ... Genus-specific primers F194 (5′- CGTAACAAGGTAGCTGTAG-3′) and 5368 (5′-TTTCACTCGCCGTTACTAAGG-3′) wereDe Luca F, Troccoli A, Duncan L W, et al. Pratylenchus speijeri n. sp.(Nematoda: Pratylenchidae), a new root-lesion nematode pest of plantain in West Africa. Nematology, 2012, 14(8): 987-1004.IGS sequence variation, group-I introns and the complete nuclear ribosomal DNA of the entomopathogenic fungus Metarhizium: excellent tools for isolate detection …MP Pantou, A Mavridou, MA Typas - Fungal Genetics and Biology, 2003 - Elsevier... 18SF, GCGAAACTGCGAATGGCT, This work. 18SR, GTAATGATCCCTCCGCTG, This work. TW81, GTTTCCGTAGGTGAACCTGC, Curran et al. (1994). AB28, ATATGCTTAAGTTCAGCGGGT, Curran et al. (1994). Ma-ITS2, GTCCACTGCCGTAAAACCCC, This work.Heterodera vallicola sp. n.(Tylenchida: Heteroderidae) from elm trees, Ulmus japonica (Rehd.) Sarg. in the Primorsky territory, the Russian Far East, with rDNA …AS Eroshenko, SA Subbotin… - Russian Journal of …, 2001 - ... DNA fragments were sequenced in both directions with TW81, AB28, 5.8SM2 (5'- CTTATCGGTGGATCACTCGG-3') or 5.8SM5 (5'-GGCGCAATGTGCATTCGA-3') primers witha BigDye Terminator Cycle Sequencing Ready Reaction Kit (PE Applied Biosystems, UK)Nematode universal primers:Gymnodinium nolleri Ellegaard et Moestrup sp. ined.(Dinophyceae) from Danish waters, a new species producing Gymnodinium catenatum-like cysts: molecular and …M Ellegaard, Y Oshima - Phycologia, 1998 - ... 1989) conserved positions 708-727 (D3A; 5' GACCCGTCTTG AAA CACGGA-3') and 1011-992(D3B; 5' TCGGAAGGAACCAGCTACTA-3'). Double-stranded and sin gle-stranded PCR amplifications were performed in a ther mocycler with an initial denaturation step of 3 min atNuclear and mitochondrial DNA sequence diversity in the Antarctic nematode Scottnema lindsayaeEM Courtright, DH Wall, RA Virginia… - Journal of …, 2000 - ... The primer pairs used were D2A (5-ACAAGTACCGTGAGGGAAAGTTG-3) and D2B(5-AATCCGTGTTTCAAGACGGG-3), D3A(5-GACCCGTCTTGAAA- CACGGA-3) and D3B(5-TCGGAAG- GAACCAGCTACTA-3) (Nunn, 1992), and mtA (5-GGCGGATCCTACATCGATGTTGAmiri S, Subbotin S A, Moens M. Identification of the beet cyst nematode Heterodera schachtii by PCR. European Journal of Plant Pathology, 2002, 108(6): 497-506.。