MLST

Oenococcus oeni strain typification by combination of Multilocus Sequence Typing and Pulsed Field Gel Electrophoresis analysisLucía González-Arenzana,Pilar Santamaría,Rosa López,Isabel López-Alfaro*ICVV,Instituto de Ciencias de la Vid y del Vino(Gobierno de La Rioja,Universidad de La Rioja and CSIC),C/Madre de Dios51,26006Logroño,La Rioja,Spaina r t i c l e i n f oArticle history:Received24January2013 Received in revised form26July2013Accepted30July2013 Available online14August2013Keywords:PFGEMLSTOenococcus oeni a b s t r a c tOenococcus oeni is usually the main lactic acid bacteria(LAB)responsible for conducting malolactic fermentation(MLF)in wines.Pulsed Field Gel Electrophoresis(PFGE)is one of the most common methods used to identify different genotypes among the wine LAB populations.Although PFGE is a powerful typing tool,it is time-consuming and its results are not easily exchangeable between labora-tories so typing methods such as Multilocus Sequence Typing(MLST)have been developed.In this study, thirty O.oeni isolates from Rioja Tempranillo wines were characterized performing SfiI and Apa I PFGE and MLST with eight housekeeping ing the latter technique,six new alleles have been described forfive genes.PFGE was slightly more efficient than MLST because of the number of genotypes and of the index of diversity(ID)that each technique discriminated.This has been thefirst time that PFGE and MLST results have been combined to shape a unique dendrogram.Thus,the combination of results from both typing methods allowed the discrimination of twenty-two PFGE-ST genotypes showing the highest ID of these research(0.947).According to these results,the future application of the combination of PFGE and MLST results could be successful for reliable O.oeni strain typification.Ó2013Elsevier Ltd.All rights reserved.1.IntroductionThe species Oenococcus oeni has been shown to be the best adapted lactic acid bacteria(LAB)to the pH and ethanol of wine, and so it is the most frequently detected species during malolactic fermentation(MLF)(López et al.,2007;Pramateftaki et al.,2012).Several studies have been conducted so far focussing on the investigation of O.oeni biodiversity to gain insight into the complex ecosystem of wine,to select and to prepare well-defined starters of biotechnological interest in winemaking and to study the contri-bution of certain strains to wine composition(González-Arenzana et al.,2013;Izquierdo et al.,2004;Vigentini et al.,2009).All these studies have used efficient and precise molecular methods to identify and to discriminate strains.The genetical and phyloge-netical homogeneous O.oeni characteristic makes strain differen-tiation only possible through high resolution techniques such as those based on DNA analysis(Le Jeune&Lonvaud-Funel,1997). Several typing methods have been employed to identify O.oeni strains,among which macrorestriction analysis of DNA by Pulsed Field Gel Electrophoresis(PFGE)and Multilocus Sequence Typing (MLST)have been found to be the most efficient(Bilhère et al., 2009;Bridier et al.,2010;de las Rivas et al.,2004).The two methods are also interesting since they target different genetic variations:MLST reveals punctual mutations and also longer de-letions and mutations in a few genes,whereas PFGE is more sen-sitive to large-scale genomic rearrangements(Bilhère et al.,2009). Moreover,MLST targeting housekeeping genes has the advantage of generating portable and comparable data between laboratories that are used,not only for strain identification,but also for evolu-tionary and population studies(Maiden et al.,1998).In addition,some authors have reported that only the combi-nation of results from different techniques is able to provide a complete picture,especially when the aim is to study the ecology of natural microbial populations(Nigatu,2000).Other authors ach-ieved better discrimination after combining numerical analysis of the patterns obtained from PFGE and randomly amplified poly-morphic DNA(RAPD)(Ruiz et al.,2008;Sánchez et al.,2004). However,RAPD-PCR method has been critisized for lack of repro-ducibility and efficacy even when two primers were used at the same time(López et al.,2008).Therefore,this study was designed with the aim of establishing a method that completes the current way of typing O.oeni.For this purpose,PFGE with SfiI and Apa I endonucleases was performed along with the MLST of eight of the most informative housekeeping*Corresponding author.ICVV,Servicio de Investigación y Desarrollo Tecnológico Agroalimentario,Ctra.de Mendavia-Logroño(NA134,km.88),26071Logroño,La Rioja,Spain.Tel.:þ34941291383;fax:þ34941291392.E-mail addresses:isabel.lopez@,isabel.lopez@icvv.es,ilopezalfaro@ yahoo.es(I.López-Alfaro).Contents lists available at ScienceDirectFood Microbiologyjournal homepage:/locate/fm0740-0020/$e see front matterÓ2013Elsevier Ltd.All rights reserved./10.1016/j.fm.2013.07.014Food Microbiology38(2014)295e302genes (Bilhère et al.,2009;de las Rivas et al.,2004).Results have been analyzed to compare and to combine the discriminatory ability of these two typing techniques.2.Materials and methods 2.1.O.oeni isolatesThirty randomly selected O.oeni isolates were included in this study.They are part of the strain collection of CIDA Research Centre of the Spanish northern region of La Rioja and they were obtained in a previous study of LAB ecology carried out in 2006,2007and 2008vintages in several wineries in this region (González-Arenzana et al.,2013).O.oeni isolates were grown in MRS agar (Scharlau Chemie S.A.,Barcelona.Spain)modi fied with tomato juice (10%vv À1),fructose (6gL À1),cysteine-HCl (0.5gL À1)and D ,L -malic acid (5gL À1).The plates were incubated at 30 C under anaerobic atmosphere (Gas Pak System,Oxoid Ltd.,Basingstoke,England).2.2.PFGE analysisPFGE was carried out according to the method described by Birren and Lai (1993),with some modi fications for the agarose block preparation (2007).Macrorestriction analysis was performed with two endonucleases:S fiI,following the method reported by López et al.(2007),and Apa I,according to the method reported by Larisika et al.(2008)with the following modi fications:1.2%(wv À1)agarose gels were submitted to 24h with a pulse ramping between 0.5and 20s at 14 C and 6Vcm À1in a CHEF DRII apparatus (Bio-Rad Laboratories,Hercules,CA).2.3.MLST analysisGenomic DNA was extracted from fresh culture plates following the method of rapid lysis described by López et al.(2008).According to recent literature on typing O.oeni by MLST,eight housekeeping genes encoding proteins were chosen for this analysis (Table 1):ddl (D-Ala-D-Ala ligase)and gyr B (Gyrase,b subunit)described by de las Rivas et al.(2004);and rpoB (RNA polymerase,b subunit),purK (Phosphoribosylamino-imid-azole carboxylase),g6pd (Glucose-6-phosphate dehydrogenase),pgm (Phosphoglucomutase),dnaE (DNA polymerase III,a subunit)and recP (Transketolase)described by Bilhère et al.(2009).PCR was performed in order to amplify these gene fragments from DNA of O.oeni strains by using the oligonucleotides included in Table 1.Each 50m L-ampli fication reaction mixture contained 20ng template DNA,MgCl 22.5mM,20m M of each deoxynucleotide triphosphate,500mM of each primer and 2.5U BIOTAQ ÔDNA polymerase (Bioline,London,UK).PCR program was:95 C for 2min;followed by 30cycles of 95 C for 30s,58 C for 1min,and 72 C for 1min;followed by a final extension of 10min at 72 C.PCR was carried out with a Perkin Elmer Thermal GeneAmp PCR system 2700and the obtained amplicons were puri fied and sequenced in Macrogen Inc.(Seoul,South Korea).Nucleotide sequences of the eight housekeeping genes were deposited in GenBank under the following accession numbers:JX240023e JX240052(rpoB ),JX239993e JX240022(ddl ),JX240173e JX240202(purK ),JX240203e JX240232(g6pd ),JX240143e JX240172(pgm ),JX240053e JX240082(dnaE ),JX240083e JX240112(gyrB )and JX240113e JX240142(recP ).2.4.Numerical analysis of gel images and sequencesThe conversion,normalization,and further processing of the stained gel images were carried out by InfoQuest Ôsoftware version 5.1(Bio-Rad).Comparison of the pulse types obtained from the PFGE for S fiI and Apa I was made by Composite Data combined comparison with average of experiment by Unweighted Pair Group Method using Arithmetic averages (UPGMA)(Ruiz et al.,2008).The weight of the results from each endonuclease was set at the same level.The chromatograms and sequences obtained for the eight genes of the MLST scheme and the thirty bacterial isolates were analized by using InfoQuest Ô5.1.The sequences generated a consensus dendrogram by using the Composite Data combined comparison with average of experiment and UPGMA.The relevance of each gene was set at the same level to assess the dendrogram.Each different combination of allelic pro files was then determined as a sequence type (ST).Consequently,the allelic pro files that were 100%indistinguishable in the dendrogram shared the same ST.Furthermore,each distinct gene sequence was compared with the O.oeni allelic sequences deposited to date in GenBank and an allele number was assigned.The identi fication number of alleles previously determined by de la Rivas et al.and Bilhère et al.was assigned to identical sequences (Bilhère et al.,2009;de las RivasTable 1Genes and primers employed for MLST analysis.Gene Enzyme function Primer Sequence (50-30)Amplicon size (bp)ddl D-Ala-D-Ala ligase ddl-1CGATGTTAGCAAGCGTTCG 911a ddl-2TTCGTATTTCCCGGTAGTG gyrB Gyrase,b subunitgyrB-1TGGGCTTCATGGTGTTGGC 947a gyrB-2CCCTCGACGATAAACAATTC rpoB RNA polymerase,b subunitrpoB-1CGATATTCTCCTTTCTCCAATG 665b rpoB-2CTTTAGCGATCTGTTCCAATG purK Phosphoribosylamino-imidazole carboxylase purK-1TGGTTATCATGTTGGTATTTTGG 597b purK-2GAAGCAGGAGCATAGGAAAGA g6pd Glucose-6-phosphate dehydrogenase g6pd-1TTATATGTCTGTTGCTCCTCGT 669b g6pd-2CCGGTTCTGATGTAAAAAGG pgm Phosphoglucomutasepgm-1ATATCTGCCGAAGTGCTAAGAG 654b pgm-2AGCAGCAATTTGATTTCCAG dnaE DNA polymerase III,a subunit dnaE-1CGTATATAGAGCGCTTTGCC 714b dnaE-2CGTTCTTATCGCGAGTTGTAC recPTransketolaserecP-1AGCGACAAACCATCCTTTATC 676brecP-2CGACAGCTAAGGAATCATGAGa de la Rivas et al.(2006).bBilhère et al.(2009).L.González-Arenzana et al./Food Microbiology 38(2014)295e 302296et al.,2004).The new alleles described in this study that had never been submitted to GenBank database were assigned Roman numerals.Combination of the obtained pulse types from SfiI and Apa I PFGE analysis and MLST sequences were made by Composite Data comparison with average of experiment and UPGMA,setting the weight of the results from each technique at the same level.A consensus dendrogram was generated and so it was possible to bring together PFGE and sequence results.parison of typing method resultsThe index of diversity(ID)was calculated using Simpson’s Index of Diversity(Hunter,1990).Values closest to1meant the highest power of discrimination of the method.The ID for PFGE analysis was calculated including both endonucleases SfiI and Apa I.The ID for MLST was assessed separately for each gene and also for overall MLST scheme.Finally,the ID for combined PFGE and MLST results was also calculated.3.Results3.1.PFGE typingThe thirty isolates included in this study were submitted to PFGE using SfiI and Apa I restriction enzymes.The PFGE results showed that Apa I discriminated eighteen genotypes,one less than SfiI(data not shown).Finally,nineteen distinct PFGE patterns were identified combining the results obtained with both enzymes (Fig.1).The isolates were grouped in two major clusters at64% similarity level.Cluster A included twelve isolates with unique genotypes while seven genotypes representing eighteen isolates made up cluster B.PFGE genotypes17,18and19,contained each one two isolates with identical electrophoretic profiles.PFGE% Similarity PFGE-Sfi I PFGE-Apa I Isolate Year GenotypeCluster ACluster B195985875765G2A1A8H3D2L1E5J1H2A9C1D1A3A2E4H1A7A6E1F1H4F2A10K1G1G3A5E3A4E2200620062007200620082006200720082006200820062007200620062006200620062006200620062007200720082006200620072006200620062006PFGE 1PFGE 2PFGE 3PFGE 4PFGE 5PFGE 6PFGE 7PFGE 8PFGE 9PFGE 10PFGE 11PFGE 12PFGE 13PFGE 14PFGE 15PFGE 15PFGE 15PFGE 16PFGE 16PFGE 16PFGE 16PFGE 16PFGE 16PFGE 16PFGE 17PFGE 17PFGE 18PFGE 18PFGE 19PFGE 19100100100100100Fig.1.Consensus dendrogram obtained by combining SfiI-PFGE,Apa I-PFGE pulse types of thirty O.oeni isolates showing cophenetic correlation values.Isolates were labelled with different letters corresponding to different wineries of the Rioja Spanish northern region.L.González-Arenzana et al./Food Microbiology38(2014)295e302297genotype 15included three isolates with indistinguishable pulse types and PFGE 16included seven isolates sharing the same pro file.The remaining two isolates (PFGE 13and 14)showed unique PFGE patterns.The strains typed as PFGE 15,18and 19included isolates collected during the MLF of wines from different wineries from the same vintage.The isolates grouped in PFGE 16were taken from five wineries during MLF in three vintages.Only isolates typed as PFGE 17were obtained from a unique winery in separate years (Fig.1).3.2.MLST typingThe thirty isolates were also submitted to MLST typing tech-nique.Eight housekeeping genes rpoB ,ddl ,purK ,g6pd ,pgm ,dnaE ,g yrB and recP ,were targeted in this MLST analysis (Table 1).A consensus dendrogram was generated using the obtained sequences (Fig.2).Isolates with 100%similarity level were assigned the same ST and sixteen STs were identi fied.The STs were separated in two main branches at 98%similarity level (Fig.2).Branch A included twenty-seven isolates represented by fourteen STs,and branch B was formed by three strains repre-sented by two STs.The STs 1,8,9,11and 15included each one two isolates with identical allelic pro files obtained from different win-eries,except STs 11and 15isolated in the same winery at different vintages.Moreover,ten out of the thirty isolates analyzed in this study derived from five wineries and from three vintages belonged to ST 3.Data concerning characterization results for each gene are shown in Table 2.The eight housekeeping genes allowed to determine from three to eight alleles.Ddl and rpoB were the genes that showed less alleles and purK was the gene that established the% SimilarityIsolate Year Genotype Cluster ACluster B1009998E4H1 H2A6 E1F1H4F2A10A3 A9 K1A7G2 A2A5D1 H3 C1 D2 A1A4E5 E2E3J1 A8 G1G3L1200620062006200620062006200720072008200620082006200620062006200620072006200620082006200620072006200620082007200620072006ST 1ST 1ST 2ST 3ST 3ST 3ST 3ST 3ST 3ST 3ST 3ST 3ST 3ST 4ST 5ST 6ST 7ST 8ST 8ST 9ST 9ST 10ST 11ST 11ST 12ST 13ST 14ST 15ST 15ST 16Fig.2.Consensus dendrogram obtained by combining sequences of the eight housekeeping genes (rpoB,ddl,purK,pgm,g6pd,dnaE,gyrB and recP )ampli fied from the thirty O.oeni strains genomes showing cophenetic correlation values.Isolates were labelled with different letters corresponding to different wineries of the Rioja Spanish northern region.L.González-Arenzana et al./Food Microbiology 38(2014)295e 302298most different ones.In addition,the Simpson’s Index of Diversity (ID)proposed by Hunter(Hunter,1990)calculated for the genes gave the smallest value for rpoB and the largest one for purK.The comparison of the sequences from this study with the ones already deposited to date in the GenBank database revealed six new alleles that had never been described before and that were represented by Roman numerals(Table2).The allele I of ddl gene was the only one that showed a silent mutation;however,the other new alleles(I and II of gyrB and I of recP,pgm and purK)were characterized by non-synonymous substitutions(data not shown). Finally,the alleles previously deposited in GenBank were taken into consideration.Thus,the non-new alleles were named with the numbers that other authors had previously established(Table2).bination of PFGE and MLST resultsResults of both techniques PFGE and MLST(Fig.3)were used to construct a consensus dendrogram.The results of this dendrogram showed the presence of twenty-two PFGE-ST genotypes among the thirty isolates analyzed.The dendrogram was shaped by two main clusters split at76% similarity level.Cluster A was quite complex including ten PFGE-ST genotypes made by eighteen isolates,whereas cluster B was composed of twelve isolates typed as twelve unique PFGE-ST genotypes.There were two PFGE-ST genotypes(3and8)integrated by two isolates while PFGE-ST5included seven isolates of this study.These PFGE-STs grouped isolates that were recovered from several win-eries in three vintages(PFGE-ST5)or in one vintage(PFGE-ST3),except PFGE-ST8whose isolates derived from the same winery at different vintages.parison of techniques:PFGE versus MLSTThe discriminatory ability of PFGE and MLST was compared by the number of genotypes(ST,PFGE and PFGE-ST genotypes)and isolates integrating those genotypes.The ID for MLST was0.885,for PFGE was0.937and the combination of both was0.947(Table2).Results showed that two PFGE genotypes(15and18)made by three and two isolates respectively,were distinguished by MLST defining four STs;so PFGE15was separated into ST1(with two isolates)and ST3,and PFGE18into ST6and ST12.On the other hand,four STs(3,8,9and11)integrated by a total of eighteen isolates resulted in ten PFGE genotypes.In this way,ST3 was split into PFGE10,13,15and16;ST8was established as PFGE4 and PFGE11;ST9as PFGE2and5;finally,ST11as PFGE7and19.The PFGE-ST combination showed three groups(PFGE-ST3,5 and8)that were identically typed by both techniques.PFGE-ST3 integrated isolates from the same year and from different wineries, PFGE-ST5was formed by isolates from different wineries and years and PFGE-ST8included isolates from the same winery and from different years(Table2).4.DiscussionIn this study two different typing methods,PFGE and MLST, were carried out for thirty O.oeni isolates obtained from ferment-ing wines.Table2Origin and typing data of the thirty O.oeni isolates analyzed in this study.Alleles without superlow script letters were described by Bilhère et al.(2009),alleles with d were described by de la Rivas et al.(2006)and alleles in bold Roman numbers were not previously described.Isolates a Isolation year Alleles Genotypesddl rpoB dnaE gyrB recP pgm g6pD purk ST PFGE PFGE-STA320061125-6d1-1d4-8d423131A220061125-6d8-2d7175142E420061125-6d1-1d5-2d121153H120061125-6d1-1d5-2d121153A720061125-6d1-1d4-8d423154A620061125-6d1-1d4-8d423165E120061125-6d1-1d4-8d423165F120061125-6d1-1d4-8d423165H420071125-6d1-1d4-8d423165F220071125-6d1-1d4-8d423165A1020081125-6d1-1d4-8d423165K120061125-6d1-1d4-8d423165A5200611211-7d25-2d116186E32006251310115-2d31912187G1*******I5I11815178G3*******I5I11815178A42006251210115-2d3I10199E220062513101114319111910G22006I125-6d1-1d1124111A12006251210115-2d3129212A82007251310I1431914313H320062512II115-2d3128414L120062276-4d5I11816615E52007251310111431911716J12008211310115-2d31913817H220061125-6d1-1d4-8d122918A920081125-6d1-1d4-8d4231019D12007112475-2d1771220D22008251210115-2d3129521D120062512II115-2d31281122Total number b33577648161922Index of diversity(ID)c0.5450.5580.6390.6990.7010.7330.7380.7450.8850.9370.947a Isolates were labelled with different letters that correspond to different wineries of Rioja Spanish northern region.b Total number of differentiated alleles of genotypes.c ID¼1À[1/N(NÀ1)]S nj(njÀ1),where N is the total number of strains and n is the number of strains belonging to a genotype.L.González-Arenzana et al./Food Microbiology38(2014)295e302299PFGE technique has been the most frequently used method to type bacteria in clinical and food microbiology (Vernile et al.,2009).Many studies based on PFGE were developed with more than one restriction enzyme,in order to improve the discriminatory ability of O.oeni strain typing by PFGE (Guerrini et al.,2003;López et al.,2008;Zapparoli et al.,2009).The results obtained in this study with Apa I were not complementary to the ones obtained with S fiI because Apa I discriminated one less genotype than S fiI.These re-sults were in agreement with those described by other authors who recognised that the employment of S fiI endonuclease is one of the best options for typing O.oeni by PFGE (Larisika et al.,2008;López et al.,2008).The dendrogram obtained combining S fiI-Apa I PFGE provided two de fined clusters.However,neither group was shaped by the winery,year or isolation stage.The MLST scheme used in this study was de fined after checking previous literature concerning this technique applied to different LAB (Bilhère et al.,2009;de la Rivas et al.,2006;de las Rivas et al.,2004).It has been suggested that better results can be obtained by increasing the number of housekeeping genes.Nevertheless,these same authors have con firmed that there is a point where it is not worth studying more loci because the results do not become more discriminating (Urwin and Maiden,2003).Therefore,genes and primers that provide more information about O.oeni typing were chosen.Every targeted gene showed its polymorphic condition so that the strategy for typing with the MLST scheme used in this study gave a suitable result.To the best of our knowledge,for the first time,complete pro-cessing of MLST scheme has been performed without concatenated sequences using the InfoQuest Ôsoftware.The results obtained in this way allowed to determine that isolates with 100%similarity at the dendrogram were determined as the same ST.Although this dendrogram was formed by two main clusters,like the PFGE dendrogram,they had a completely different organization.First of all,in the MLST dendrogram,the point where both branches arose% SimilarityIsolate YearGenotypeCluster ACluster B100999897969594939291908988878685848382A3 A2E4H1 A7A6 E1F1H4F2A10K1A5E3G1G3A4E2G2 A1A8H3 L1 E5 J1 H2 A9D1 D2 C1 200620062006200620062006200620062007200720082006200620062006200720062006200620062007200620062007200820062008200720082006PFGE-ST 1PFGE-ST 2PFGE-ST 3PFGE-ST 3PFGE-ST 4PFGE-ST 5PFGE-ST 5PFGE-ST 5PFGE-ST 5PFGE-ST 5PFGE-ST 5PFGE-ST 5PFGE-ST 6PFGE-ST 7PFGE-ST 8PFGE-ST 8PFGE-ST 9PFGE-ST 10PFGE-ST 11PFGE-ST 12PFGE-ST 13PFGE-ST 14PFGE-ST 15PFGE-ST 16PFGE-ST 17PFGE-ST 18PFGE-ST 19PFGE-ST 20PFGE-ST 21PFGE-ST 22Fig.3.Consensus dendrogram obtained by combining S fiI and Apa I-PFGE,and sequences of the eight housekeeping genes (rpoB ,ddl ,purK ,pgm ,g6pd ,dnaE,gyrB and recP )ampli fied from the thirty O.oeni strains genomes showing cophenetic correlation values.Isolates were labelled with different letters corresponding to different wineries of the Rioja Spanish northern region.L.González-Arenzana et al./Food Microbiology 38(2014)295e 302300was close to100%similarity which made us expect a low discrimination power of this technique.Furthermore,cluster A included most of the typed strains,whereas cluster B was shaped by ST15and ST16.These two strains shared new mutations in the polymorphic gyrB and pgm genes.Some studies have described similar results for strains that underwent similar conditions as a result of adaptation to a new or different niche(Bilhère et al.,2009; Bridier et al.,2010;Molenaar et al.,2005).Nonetheless,in this study these three isolates were gathered from wines elaborated in different vintages and one of them in a different winery,so the winemaking conditions were completely different.In relation to the analyzed loci,it was observed that ddl and rpoB genes provided lowest ID which was in agreement with other re-ports(Bridier et al.,2010).However,in this study ddl gene enabled us to define a new allele(JX240002).The sequencing of gyrB and recP genes led to intermediate results because they differentiated several alleles but did not include many isolates.This made ID low because of the small number of defined genotypes.The opposite situation was found with sequences from pgm and g6pd genes, since higher ID was noted with less determined alleles.Actually,the gene with more significance in this study was purK showing an ID of0.745and defining seven genotypes and a new allele.In spite of these results,any loci should be excluded from this study because they were useful in defining new alleles and moreover in any case the ID calculated for one gene was superior to the ID shown with the eight housekeeping genes.Our results have demonstrated the presence of six new alleles that were defined by four of these genes (JX240002for ddl gene;JX240110and JX240100for gyrB gene; JX240141for recP gene;JX240157for pgm gene and JX240182for purK gene).In addition,five out of the six were characterized by non-synonymous substitutions per base that altered the amino acid sequence and only one suffered from a silent mutation(de la Rivas et al.,2006).This study is thefirst to combine electrophoresis images with chromatograms of sequences to provide a unique dendrogram.This option made it possible to take into consideration several typing methods,as PFGE with different restriction enzymes and MLST with different housekeeping gene sequences.The resulting dendrogram showed that two differentiated clusters arose at76% similarity which was intermediate between the level of similarity of two branches obtained by PFGE(68%)and by MLST(98%).As in the PFGE dendrogram,one cluster of the consensus dendrogram (cluster A)included mostly PFGE-ST genotypes composed by more than one isolate and the other(cluster B)consisted of every unique PFGE-ST genotype.Comparison of results from MLST,PFGE and the combination PFGE-MLST was based on the number of genotypes,on the ID and on the way of clustering of each technique.A good discrimination level was determined with combined MLST-PFGE method,not only in number of determined genotypes(twenty-two)but also in ID value(0.947),which meant a95%probability of differentiating two randomly selected strains(Bilhère et al.,2009).Comparison be-tween PFGE and MLST results has been previously carried out in several studies(Al Nakib et al.,2011;Bilhère et al.,2009;Johnson et al.,2007;Picozzi et al.,2010).Overall,it was observed that the ID of PFGE and the number of detected genotypes were higher than those obtained using the MLST although it was slightly lower than the one for combined PFGE-MLST.Thus,in this study a better discrimination level of PFGE versus MLST for O.oeni has been demonstrated which was opposite of the results obtained by other authors(Bilhère et al.,2009).In relation to the way of clustering,it was evident that strains grouped in branches from the PFGE dendrogram were completely different to those grouped in branches in the MLST dendrogram.This different way of clustering has been previously reported by other authors in other LAB species (Picozzi et al.,2010).The lack of concordance in the clustering and typing results of MLST and PFGE is based on the different evolution rate that both techniques show.PFGE is based on restriction frag-ments so mutations,insertions or deletions in the enzyme recog-nition site may alter the electrophoretic profile and may be significant of genome rearrangements(Picozzi et al.,2010). Whereas MLST is able to detect little mutations showing a neutral diversity and evolution rate(Bridier et al.,2010).In conclusion,in relation to methodology this study confirmed that endonuclease SfiI was successful in O.oeni strain typing. Moreover,the eight targeted housekeeping genes were poly-morphic although some of them resulted in low ID.This study has made possible to determine six new alleles that had never been described in the literature.It has been also determined that PFGE was slightly more discriminatory than MLST although MLST allows to develop population studies.The lack of concordance between typing results of MLST and PFGE was due to the different rates of genetic changes that each one represented so an evidently distinct way of clustering was demonstrated.This has been thefirst time that PFGE and MLST results have been combined and it was demonstrated that combination of both techniques was the most discriminatory strategy for O.oeni characterization.Future studies for analyzing O.oeni populations should be focused on the com-bined MLST and PFGE results to improve the discriminatory ability of both techniques.AcknowledgementsThis study was supported by funding and a predoctoral grant (B.O.R.6th March,2009)from the Government of La Rioja,the I.N.I.A.project RTA2007-00104-00-00and FEDER of the European Community and was made possible thanks to the collaborating wineries.ReferencesAl Nakib,M.,Longo,M.,Tazi,A.,Billoet,A.,Raymond,J.,Trieu-Cuot,P.,Poyart,C., parison of the diversilab(R)system with multi-locus sequence typing and pulsed-field gel electrophoresis for the characterization of Streptococcus agalactiae invasive strains.Journal of Microbiological Methods85(2),137e142. Bilhère,E.,Lucas,P.M.,Claisse,O.,Lonvaud-Funel,A.,2009.Multilocus sequence typing of Oenococcus oen i:detection of two subpopulations shaped by intergenic recombination.Applied and Environmental Microbiology75(5),1291e1300. Birren,B.,Lai,E.,1993.Pulsed Field Gel Electrophoresis.a Practical Guide.Academic Press,San Diego.Bridier,J.,Claisse,O.,Coton,M.,Coton,E.,Lonvaud-Funel,A.,2010.Evidence of distinct populations and specific subpopulations within the species Oenococcus oeni.Applied and Environmental Microbiology76(23),7754e7764.de la Rivas,B.,Marcobal,A.,Muñoz,R.,2006.Development of a multilocus sequence typing method for analysis of Lactobacillus plantarum strains.Microbiology-sgm 152,85e93.de las Rivas,B.,Marcobal,A.,Muñoz,R.,2004.Allelic diversity and population structure in Oenococcus oeni as determined from sequence analysis of house-keeping genes.Applied and Environmental Microbiology70(12),7210e7219. González-Arenzana,L.,Santamaría,P.,López,R.,López-Alfaro,I.,2013.Indigenous lactic acid bacteria communities in alcoholic and malolactic fermentations of Tempranillo wines elaborated in ten wineries of La Rioja(Spain).Food Research International50,538e545.Guerrini,S.,Bastianini, A.,Blaiotta,G.,Granchi,L.,Moschetti,G.,Coppola,S., Vincenzini,M.,2003.Phenotypic and genotypic characterization of Oenococcus oeni strains isolated from Italian wines.International Journal of Food Microbi-ology83(1),1e14.Hunter,P.R.,1990.Reproducibility and indexes of discriminatory power of microbial typing methods.Journal of Clinical Microbiology28(9),1903e1905. Izquierdo,P.M.,García,E.,Martínez,J.,Chacón,J.L.,2004.Selection of lactic bacteria to induce malolactic fermentation in red wine of cv.Cencibel.Vitis43(3),149e 153.Johnson,J.K.,Arduino,S.M.,Stine,O.C.,Johnson,J.A.,Harris,A.D.,2007.Multilocus sequence typing compared to pulsed-field gel electrophoresis for molecular typing of Pseudomonas aeruginosa.Journal of Clinical Microbiology45(11), 3707e3712.Larisika,M.,Claus,H.,Koenig,H.,2008.Pulsed-field gel electrophoresis for the discrimination of Oenococcus oeni isolates from different wine-growing regions in Germany.International Journal of Food Microbiology123(1e2),171e176.L.González-Arenzana et al./Food Microbiology38(2014)295e302301。