重组门冬酰胺酶II制备与分析英文版

Experiment 1 Construction of Recombinant Expression Asparaginase IIEngineered Bacteria[Purpose]1.Learn the principle of building a recombinant plasmid2.Master the basic techniques of plasmid extraction, PCR technology and digestedmethod.[Principle]AsparaginaseAsparaginase, it is also called L-asparagine.L-asparagine is the essential amino acids of the protein synthesis in the cells. Asparagine synthetase enzyme content is very low in the tumor cells, it can not be synthesized L-asparagine and must rely on exogenous L-asparagine to survive. L-asparagine amidase can digest L-asparagin and thus suppressing the normal synthesis of the protein in the tumor cells, resulting in the death of the tumor cells. Normal cells can synthetize L-asparagine, and have no rely on L-ASP. Therefore, L-ASP can be used for treating acute lymphoblastic leukemia. Current clinical use of L-ASP mainly refers to E.coli L-ASP II. At present, the clinical use of asparaginase derives from E.coli. Biochemical pharmaceutical factory in Tianjin began producing L-ASP in 1974. In 1995, Professor Wu Wutong clone and express E.coli asparaginase gene named ansB, and for the first time successfully build a highly efficient expression of L-ASP genetic engineering bacteria pKA / CPU210009 in our country，which has 100 times fermentation units than the wild-type strains. Subsequently, he optimized the culture conditions and fermentation process, determined the purification of recombinant L-ASP route, and recombinant products were identified. Preparation of L-ASP and purification process is more and more mature. This result opened a new road for high-quality and low-cost injection L-ASP with E. coli.Polymerase chain reaction (PCR)The polymerase chain reaction (PCR) is enzymatic synthesis of specific DNA fragments in vitro, using a DNA denaturation and refolding characteristics, denatured by the high temperature, low temperature annealing (renaturation) and the optimum temperature extension reaction steps to form a cycle, rapidly amplify of the target DNA with specificity, high sensitivity, easy to operate and saving time.The double digestionPerforming PCR amplification time, designed restriction sites to both ends of the primer, the choice of restriction enzyme is very important. Generally, try to choose the sticky ends digested and high efficiency restriction enzyme, such as BamHI, HindIII.You should know the public buffer in advance, as well as the efficiency of each enzyme in public buffer. Plus a protective base on both sides of the respective enzyme after cleavage sites has been selected. Many people recommend digested overnight. It’s not necessary. Generally digested three hours, in fact, one hour is sufficient if application of large systems, such as 100 microliters.PurificationPCR products were purified with pillar or column. It is easy to cut chunks of rubber when using tapping techniques thus affecting the efficiency of the purification. Column purification can remove the primer; in that case, several digested bases are also purified away. Therefore, the PCR product and the product of double digestion can be purified with column.[Materials]1. ReagentspET22b broththe pET28a-AnsB plasmidLB liquid mediumAmpicillin (Amp)AgaroseTAE bufferDyeLoading BufferMarkerPCR kitDigestion kitPurification kit2. ApparatusMicropipetStandard Clean BenchElectronic balance (accurate to 10mg)Constant temperature water bathCentrifugeEppendorf tube rackSterile pipette tipsSterilized Eppendorf tube (1.5 ml microcentrifuge tube)PCR InstrumentElectrophoresis SystemGel Imaging SystemShaker[Procedures]1 PCR1.1 PCR reaction system is as followsPrimer sequenceECAnsB-1: catgccatggatggagtttttcaaaaagacggc (Nco I)ECAnsB-2a: cccaagcttgtactgattgaagatctgctgga (Hind III)10× PCR Buffer 5 µldNTP Mixture(各 2.54 µlmmol/L)TaKaRa rTaq（5 u/µl）0.5 µlMgCl2 4 µlForward Primer（20 μmol/L）2 µlReverse Primer（20 μmol/L）2 µlDNA template1 µl(pET28a-AnsB)Sterile distilled water up to 50 µlDNA template is plasmid pET28a-AnsB (pre-prepared) and the program is designated “Z1”.PCR amplification program: 95 ℃，1.5 min；95 ℃，30 sec，52 ℃，30 sec，72 ℃，1.5 min，30 cycles；72 ℃ 10min.1.2 ElectrophoresisElectrophoresis conditions: 1% agarose gel electrophoresisPreparation method: 50ml TAE buffer +0.5 g agarose, microwave heating to boiling to fully clarified, adding 5μl GOLDWA VE staining liquid, insert a small comb. Spotting: 2.5 μl sample +1 μl 6 × or 10 × Loading BufferElectrophoresis time: 120V constant voltage 30 minMarker:①. DL2000: each 5 μl of electro phoresis, a 750 bp DNA fragment is about 150 ng, display bright band, the remaining bands of DNA about 50 ng.②. λDNA digest DNA: Heat before electrophoresis (60 °C, 5 minutes), enabling the Marker electrophoretic image becomes more clear.2 Plasmid extractionThe plasmid used in this experiment is pET22b.Culture conditions: LB liquid medium (containing ampicillin 100 μg / ml) at 37 ° C 200 rpm shaker oscillation cultured overnight. Take 3ml broth for centrifugation (the same EP tube repeated centrifugal twice), cells were collected in accordance with the completion of the operation process of Axygen kit. Note as follows:①. The culture supernatants clean.②. The solution2 cleavage time should not be too long.③. After adding the solution 3, mix upside and down.④. Solution1 contain RNase, to be stored at 4 ℃.⑤. Plasmid extraction is complete, and dissolved in 50μl of eluent.Plasmid electrophoresis detection conditions are the same as PCR detection conditions.see 1.2.3 DigestionDigest plasmid and PCR product in accordance with the following systems in a PCR tube.10×Buffer 5 µlNco I 1 µlHind III 1 µlPlasmid or PCR product 20 µl50 µlNuclease-Free Water to finalvolumeIf it is fast enzyme, the restriction endonuclease amount is 1μl. If it is a common enzyme, restriction endonuclease adds 2μl.Digestion conditions: 37 ° C incubation 3h.The plasmid can not be fully used for digestion, to take 5μl empty vector as positive control used for transformation experiments.4 Digestion products purifiedThe cleavage products and the PCR products should be purified before connection.The length of purified PCR fragment is 5.8kb (plasmid digested fragment) and 1.2kb (PCR digested).4.1 PurifiedDigested PCR product and plasmid purification process refer to manual.4.2 ElectrophoresisThe condition of electrophoresis and PCR conditions is the same, see 1.2.Compare the brightness of the purified product with the DNA Marker to evaluate the molecular content.(DL2, 000 DNA Marker is composed of DNA fragments 2,000 bp ,1,000 bp, 750 bp, 500 bp, 250 bp and 100 bp. 5 μl for each electrophoresis, the 750 bp DNA fragment is about 150 ng, showing bright band, the remaining strips of DNA are about 50 ng.)[Questions]How to select the system of the restriction sites and double digestion buffer?Experiment 2 Preliminary identification of the engineered bacteria which isRecombinant expression of Asparaginase II[Purpose]1. Understand the principle that prokaryotic cells express recombinant protein vectors.2. Grasp the preliminary identification methods of the recombinant plasmid.[Principle]The connection of digested and the recovered PCR product with the vectorThe calculation of the molar ratio, beginners should carefully calculate from the beginning. Vector fragment recovered: Recycling PCR product fragment from 1:3 to 1:10, generally the former 0.03pmol, latter take 0.3pmol. pmol units of DNA is converted to μg DNA units: (X pmoles of × length bp × 650) / 1,000,000 (Note: Length bp × 650 is the molecular weight of the double-stranded DNA) The resulting figure is the μg, it can be directly used the formula set .1 pmol of 1000bp of DNA =0.66μg, such as the carrier is 5380bp, 0.03pmol the 0.03 × 5.38 × 0.66 = 0.106524μg.The concentration of DNA can be measured using micro-visible spectrophotometer, OD value is typically about 1.7-1.9. The ligase units defined as follows: 20 μl of the ligation reaction system, 6 μg the λDNA-Hind III of decomposition reaction for 30 minutes at 16 ℃, more than 90% of the DNA segment is connected, the required amount of the enzyme is defined as an activity unit (U). The concentration is completely sufficient about 350 U / μl. Ligase is easily inactivated, so operate it in the low-temperature, for example using ice and three hours is enough.Competent cellInduce cells using physical and chemical methods to make the cells in the optimum physiological state of intaking and accommodating foreign DNA. In the molecular biology experiments, cells can turn into competent cells which can accept foreign DNA by special treatment .Not only we can test whether the recombinant vector was successfully constructed, the most important is competent cells can host a follow-up experiment as a recombinant vector when the constructed vectors were transfected into competent cells for expression, such as protein expression and purification an so on.. Two common methods are used:Electroporation:After the cells and DNA were mixed, high voltage pulse is used. Then they are recovery within eutrophic ed for transformation of yeast cells.Chemical methods:The cells were suspended in the calcium chloride solution at 0℃, then the foreign DNA is put in (generally plasmids), placed for about half an hour after mixing. They are heated to 42℃ (heat shock) by Short-term (usually 75-90 seconds), adding nutritious medium for recovery.The method generally used for prokaryotic cells, in particular the transformation of E.coli.The method of CaCl2:1. Puting the rapid growth of E. coli at a low temperature (0 ℃) pretreatment of hypotonic solution of calcium chloride, will cause cell expansion.At the same time, Ca2 +causes the membrane phospholipid bilayer to form a liquid crystal structure, which prompt the part of the nucleic acid enzymatic hydrolysis of the cells in the adventitia and intima gap left to leave area and induced the cells to become competent cells. The permeability of cell membrane is changed, making it easily adhered with foreign DNA and formed anti-deoxyribonuclease hydroxy - calcium phosphate complexes on the cell surface.2. At this time, the system was transferred at the temperature of 42℃being a short thermal stimulation (90s).The liquid crystal structure of the cell membrane violent disturbances, and then many gaps appear. Foreign DNA can be absorbed by cells.The Foreign DNA in the cells is in the progress of replication and expression, achieving the transfer of genetic information.Then the receptor cells emerge the new genetic trait.3. The transformed cells were cultured on selective medium to screen the positive clones having foreign DNA.[The experimental material]1. ReagentConnection KitE. coli Bl21.LB liquid medium.LB solid medium.Ampicillin (Amp).CaCl2 solution.2. ApparatusMicropipettorStandard Clean BenchConstant temperature water bathRefrigerated centrifugeEppendorf tube rackSterile pipette pipette tipsSterilized Eppendorf tube (1.5 ml microcentrifuge tube)ShakerSpectrophotometerIce makerIncubatorElectromagnetic stirrerPH meter[Procedures]1 Connection systemConnecting in the PCR tube as the following systems:T4 DNA Ligase ( 400 U/µl，0.5 µlNEB )10×Ligase buffer 2 µlPlasmid 50~100ngPCR product 50~100ng20 µlNuclease-Free Water to finalvolumePlace on ice for 3h or 16℃overnight. When the content of the plasmids and PCR product considerable, both the ends of the molar concentration ratio of about 1:5.2 Transformation2.1 The preparation of E. coli competent cell (the method of CaCl2)Separate the single bacteria of E. coli Bl21 (DE3) through streaking in advance. Take 300μl from the glycerol tube. Then inoculate into LB liquid medium and cultured overnight. The next day, transfer to 100 ml LB medium as the ratio of 1:50. When the OD600 reaches 0.5-1.0, prepare the competent cells as the following processes:1.Transfer 1.5ml broth to a centrifuge tube. And place on ice for 10 minutes. Then centrifuge at 5000 rpm for 5 minutes at 4 ℃.2.Discard the supernatant (dumping off the supernatant gently and remove excessive moisture with a pipette).3.Adding 1ml precooling 0.05 mol/L CaCl2 solution, gently struck the bottom of the tube to make the cells completely suspended. Then placed on ice for 15 min, centrifuged at 5000 rpm for 5 minutes at 4℃.4.Discard supernatant, adding 0.2ml 0.05 mol/L pre-cooling CaCl2 solution, then gently suspended cells. That is competent cells. Distribute the state of cell suspension into two parts, each 100µl (pay attention to the suspension density should be uniform). Placed on ice to spare (preparation 4 parts for each team).5.Stored at -80℃ for the unused competent cells.Attention:The cells which have been treated with CaCl2 are relatively weak, so operate as tenderly as we can.2.2 The Transformation of Ligation products1. Add 10μl ligation product, 10μl deionized water (negative control) and 1μl pET22b empty vector (positive control) to three 100μl competent cells, respectively, using sterile suction. And gently rotate or flick wall to mix. The contents were placed on ice for 30 min.2. Place the tube at 42℃, heat shock for 90s, and without shaking the centrifuge tube.3. Transfer the centrifuge tube in an ice bath quickly and cooled to 1-2 min.4. Add 800 ml LB liquid medium to each tube, shaking culture 37℃ for 1 h.5. Lessons 100μl competent cells that have been transformed and add to the LB plates containing a selective. Then daub gently cells evenly to the surface of the agar plate using an L-type glass rod.6. Culture at 37℃ for 12-16h, observe with the petri dishes and take a picture. [Questions]1.What is the problem established using the negative control and positive control inthe conversion experiments?2.What is the reason to cause recombinant plasmid PCR results for negative?Experiment 3 Separation and Purification of Recombinant Asparaginase II [Purpose]1.Understand the principle and method of the recombinant engineered bacteria fermentation and induced expression of recombinant asparaginase II.2.Master the fractional precipitation of protein by ammonium sulfate [Principle]FermentationMulti-fingered the process that organism decompose some kind of organic matter .Fermentation is a biochemical reaction that human contact earlier, and now is widely used in the food industry, biotechnology and chemical industries.It is also the basic process of bioengineering--fermentation engineering.The study of the mechanism as well as process control continues.Fermentation is such a biological oxidation:In the absence of exogenous final electron acceptor，energy heterotrophic microorganism cells on the reduction of the energy of oxidation of organic couple compounds with the endogenous (already after the cell metabolism) for ually phosphorylated by containing cytochrome, etc. on the electron transfer chain of electron transfer and electron transfer does not occur,but to obtain the metabolizable energy of ATP by substrate (a substrate of the kinase) level phosphorylation.NAD,the one-level electron carrier which is released with energy organic compounds, directly hand the electron to endogenous organic electron acceptor as the form of NADH to regenerate NAD,while restoring the latter into the fermentation product (incomplete oxidation products).Salting-out:There are hydrophobic amino acids and hydrophilic amino acids in protein molecules. After protein folding in aqueous solution, hydrophobic amino acids usually form protected hydrophobic areas while hydrophilic amino acids interact with the molecules of solvation and allow proteins to form hydrogen bonds with the surrounding water molecules. If enough of the protein surface is hydrophilic, the protein can be dissolved in water. When the salt concentration is increased, some of the water molecules are attracted by the salt ions, which decreases the number of water molecules available to interact with the charged part of the protein. As a result of the increased demand for solvent molecules, the protein-protein interactions are stronger than the solvent-solute interactions; the protein molecules coagulate by forming hydrophobic interactions with each other. This process is known as salting out.Ammonium sulfate precipitation:Ammonium sulfate precipitation is a method used to purify proteins by altering their solubility. It is a specific case of a more general technique known as salting out. Ammonium sulfate is commonly used as its solubility is so high that salt solutions with high ionic strength are allowed. The solubility of proteins varies according to the ionic strength of the solution, and hence according to the salt concentration. Two distinct effects are observed: at low salt concentrations, the solubility of the protein increases with increasing salt concentration (i.e. increasing ionic strength), an effect termed salting in. As the salt concentration (ionic strength) is increased further, the solubility of the protein begins to decrease. At sufficiently high ionic strength, the protein will be almost completely precipitated from the solution (salting out).[Materials]1. ReagentsLB liquid mediumAmmonium sulfateBroken wall liquid: 45% sucrose, 10 mmol/L EDTA, 200 mg/L lysozyme, pH 7.5 Sodium acetate buffer (pH 5.6)Fermentation medium (corn steep liquor medium):Corn steep liquor 50g / L ,beef extract 35g / L and monosodium glutamate 10g / L, pH 7.0, autoclaved.Adding the antibiotic ampicillin into it under sterile conditions before vaccinating.2. ApparatusMicro pipetteMagnetic stirrerPh meterV ortex mixerUltrasonic Processor[Procedures]1 Cell disruption1.1 Inocula cultivationThe recombinant plasmid used for separation and purification of protein is pET22b - AnsB.Fermentation conditions:1Take 400 µl broth from glycerol pipe to 50 ml LB liquid medium (including Kanamycin 50 µ g/ml), 37 ℃12 h (150 RPM).2Take 10 ml inocula, access to 200 ml corn steep liquor culture solution in 500 ml triangular flask, 25 ℃ 4 h (150 RPM), then add the lactose to final concentration of 10 mmol/L (200 ml add 4 ml 0.5 mol/L lactose), cultue overnight.3Centrifuged 6000 rpm 15 min in 4 ℃ for collection broth.1.2 UltrasonicationResuspension of 1 g broth with 20 ml 20 mmol/L sodium acetate buffer (pH 5.6). Ultrasonication condition:1Crushing in ice bath 20 min, pause 30 S after each 15 S, power 400 w.2In case the liquid temperature too high, centrifugal pipe of cell suspension should be kept in ice water mixture during all process,.3Centrifuged 6000 rpm 15 min, take supernatant fluid as crude enzyme extract. After Ultrasonication, determinate the activity of crude enzyme extract and precipitation to determine the formation of inclusion body from protein.Retention 1 ml samples for protein content, enzyme activity and SDS-PAGE electrophoresis analysis.2 Protein crude extraction (first ammonium sulfate precipitation)Add buffer to the enzyme extract to 50 ml, and then add 18.1 g ammonium sulfate in enzyme extract to to 55% saturation, adjust pH to 7.0, magnetic stirring 60 min in ice water bath, precipitation 4 ℃ 3 h3 Protein purification (second ammonium sulfate precipitation)1Centrifuged the first product of ammonium sulfate precipitation 6000 rpm 20 min to remove precipitation.2Add 13.6 g ammonium sulfate in the supernatant fluid to 90% saturation, adjust pH near to the isoelectric point (about pH 5.0), stirring 60 min, and 4 ℃ overnight, centrifuged 6000 rpm 30 min, frozen storage precipitation.[Questions]1. What are the reasons for the formation of inclusion bodies?2. What are the purposes of two ammonium sulfate precipitations, respectively?Experiment 4 Dialysis Desalination of Recombinant Asparaginase II [Purpose]1.Understand the principle of recombinant asparaginase II through dialysisdesalination2.Master the basic operation of dialysis[Principle]DialysisIn biochemistry, dialysis is the process of separating molecules in solution by the difference in their rates ofdiffusion through a semipermeable membrane, such as dialysis tubing. Dialysis is a common laboratory technique that operates on the same principle as medical dialysis. Typically a solution of several types of molecules is placed into a semipermeable dialysis bag, such as a cellulose membrane with pores, and the bag is sealed. The sealed dialysis bag is placed in a container of a different solution, or pure water. Molecules small enough to pass through the tubing (often water, salts and other small molecules) tend to move into or out of the dialysis bag, in the direction of decreasing concentration. Larger molecules (oftenproteins, DNA, or polysaccharides) that have dimensions significantly greater than the pore diameter are retained inside the dialysis bag. One common reason for using this technique would be to remove the salt from aprotein solution. The technique will not distinguish between proteins effectively.[Materials]1. ReagentsPhosphate buffer (pH 6.4)Sodium bicarbonate 2% (W/V)1 mmol/L EDTA (pH 8.0)2. ApparatusDialysis tubingBeakerMagnetic stirrerMicro pipette[Procedures]The collection of sediment of experiment 3 is resuspension with 10 ml 5 mmol/L phosphate buffer solution (pH 6.4).1 Dialysis tubing pretreatment methodDialysis tubing size: sift molecular weight 12000-14000.1The dialysis tubing is cut into small section of appropriate length (15 cm).2Boil the dialysis tubing 10 min in 300 ml of 2% (W/V) sodium bicarbonate and 1 mmol/L EDTA (pH 8.0).3Rinse thoroughly dialysis tubing in distilled water.4Boil the dialysis tubing 10 min in 200 ml 1 mmol/L EDTA (pH 8.0).5After cooling, deposited in the 4 degrees, must ensure that dialysis tubing always submerged in the solution. Since then must wear the gloves when take dialysis tubing. 6Before use, dialysis tubing must be filled with water and then clean.2 Dialysis1Clip clips and then check whether the dialysis tubing leakage. Fill asparagine II crude products in qualified dialysis tubing with pipette, and then dialysis with 5 mmol/L phosphate buffer.2At the beginning, change dialysis solution every 20 - 30 min, after three or four times, prolong time of changing the solution, dialysis 8 h or overnight.3Adjust the total volume to 20ml and retain 1 ml sample for protein content, enzyme activity and SDS-PAGE electrophoresis analysis.[Questions]What are the influence factors on dialysis effectivity?Experiment 5 Preliminary Identification of Recombinant Asparaginase II [Purpose]1.Learn the principle of ion column exchange adsorption technology.2.Master the methods how to isolate and purify recombinant asparaginase II byusing ion column the exchange adsorption technology.3.Master the method for detecting enzyme activity of the recombinant asparaginaseenzyme II using Nessler reagent.[Principle]Ion exchange chromatographyIon exchange chromatography is a separation analysis technology to determine the content of cations and anions in the solution based on an integrated technique of ion exchange and liquid chromatographic. Any material able to ionize in solution can be detected and separated by ion-exchange chromatography. Now it is not only applicable to the separation of a mixture of inorganic ion, but also widely used for separation of organic matter, for example, amino acids, nucleic acids, proteins and other biological macromolecules.DEAE-cellulose column chromatographyDEAE-cellulose column chromatography is an ion-exchange chromatography based on the principle that the charged biological macromolecules are isolated and purified by making exchange with the ionic groups on ion exchange chromatography medium. Its separation efficiency depends on the binding force between two reversible exchange counterparts, the macromolecules of the mobile phase and the counter ion from the ion exchange agent of the stationary phase.[Materials]1. ReagentsPhosphate buffer (pH 6.4)DEAE-52 anion cellulose0.5M NaOH0.5M HClBoric acid bufferTrichloroacetic acidNessler’s reagent2. ApparatusMicropipetteChromatography columnIron support standPeristaltic pumpAutomatic fraction collectionVacuum pump and vacuum desiccatorsRecorder[Procedures]1 PretreatmentFresh DEAE-52, a type of pre-swollen ion exchange cellulose, could be used directly without pretreatment. The used DEAE-52 should be regenerated following step 4 before column packing.2 Column packing2.1 Preparation of the exchanger1.Fetch 10 g pre-swollen DEAE52 powder, add 50 ml 5mmol / L phosphate buffersolution (pH 6.4), stand still for 10min, and then remove the fine particles in the supernatant.2.Repeat steps 1 for several times until the pH value of filtrate or supernatant is thesame with that of phosphate buffer solution.2.2 Column packingFix the clean washed chromatography column vertically on the rack, add 1/3 volume of deionized water, open the lower water outlet, and instantly pour the medium from a small beaker gently into the chromatography column, and the medium are naturally and gradually settled in the bottom of the column. Stop packing until the top of deposited gel is 1.5-2cm away from top end of chromatographic column. Connect the upper inlet port of chromatography column to a peristaltic pump, and the lower water outlet to a protein monitor. Keep liquid flow until medium inside the column is equilibrizied.2.3 Chromatography column equilibrizingTurn on the lower water outlet of the chromatography column and pump the balancing buffer into chromatography column constantly with peristaltic pump, adjust its flow rate to 0.5-1 ml/min. The balance of chromatography column is not reached until the pH value of filtrate turns the same with that of balancing buffer. In the presentexperiment, DEAE-cellulose column is equilibrizied with 5mmol / L phosphate buffer (pH 6.4).3 Sample loading and elution3.1 Sample loadingLoad the eluted enzyme solution into equilibrizied chromatography column with peristaltic pump system, and wash the hybrid protein with 5 mmol / L phosphate buffer solution until a stable baseline is achieved.3.2 Elution1.Connect gradient elution device with chromatography column.2.Fill elution bottle A (reservoir) and bottle B (mixer) of gradient elution device,with 0.2 mol / L phosphate buffer (pH 6.4) and 50 mmol / L phosphate buffer (pH6.4) respectively. Make sure liquid level of both containers are the same andremove the bubbles in their connecting vessel.3.Turn on the magnetic stirrer of gradient elution device, set its appropriate stirringspeed at which the buffers are mixed without significant swirl.4.Turn on switches of bottle A, bottle B and their connecting vessel, adjust theliquid flow rate to 5ml/5min, and collect the eluent with fraction collector.3.3 Results and calculatingDetect enzyme activity of the samples collected with fraction collection, merge the active samples into one tube, and measure its total volume. Take 1ml sample from the merged tube for protein determination and SDS-PAGE electrophoresis analysis (for SDS-PAGE analysis, the sample should be taken corresponding to the peak top of chromatography map).4 Chromatography media regenerationChromatography media could be recycled following the steps below.1.Transfer the media from the column into a beaker, shake gently while adding500ml 0.5M NaOH, and soak for 30 minutes.2.Filter, remove the supernatant. Wash the media with water until pH value reaches8.0. Filter, remove the water.3.Shake gently while adding 500ml 0.5M HCl, and soak for 30 minutes. Wash themedia with water until pH value reaches 4.0. Filter, remove the water.4.Shake gently while adding 500ml 0.5M NaOH, and soak for 30 minutes. Wash themedia with water until pH value reaches 8.0. Filter, remove the water.5.Rinse the media with deionized water, and filter with filter funnels Buehner andstore in 20% alcohol solution.。