Expression Analysis of Genes Related to Rice Resistance Against Brown Planthopper Nilaparvata lugens

Available online at ScienceDirectRice Science, 2017, 24(3): 163−172Expression Analysis of Genes Related to Rice Resistance Against Brown Planthopper, Nilaparvata lugensPanatda J ANNOEY , Duangdao C HANNEI , Jate K OTCHARERK , Weerathep P ONGPRASERT , Mika N OMURA(Department of Biochemistry, Faculty of Medical Science, Naresuan University, Pitsanulok 65000, Thailand )Abstract: Brown planthopper (BPH) is an insect species that feeds on the vascular system of rice plants. To examine the defence mechanism of rice plants against BPH, the pathogenesis-related genes (PR1a, PR2, PR3, PR4, PR6, PR9, PR10a , PR13, PR15 and PRpha ), signaling molecule synthesis genes (AOS , AXR , ACO and LOX ), antioxidant-related genes (CAT , TRX , GST and SOD ) and lignin biosynthesis-related genes (CHS , CHI and C4H ) were investigated in a resistant rice variety. AOS , PR6, PR9 and PR15 genes showed significantly increased relative expression levels at 24.38-, 19.17-, 14.71-, and 12.74-fold compared to the control. Moderate increased relative expression levels of lignin biosynthesis-related gene (C4H ), pathogenesis-related genes (PR4, PR10a and PRpha ), and antioxidant-related gene (GST ) were found, while CHI , LOX , SOD , TRX1 and AXR showed decreased relative expression levels. It was thus clearly shown that wound-induced response genes were activated in rice plants after BPH attacks through AOS activation. Jasmonic acid signaling molecule may activate PR6, PR15, GST and CAT subsequently increasing their expression for H 2O 2 detoxification. PR6 were expressed at the highest relative level among the PR genes. These genes therefore have also a considerable synergistic role with the other genes against BPH by interfered their digestion tract system. Key words: brown planthopper; rice; defense mechanism; gene expression; jasmonic acidBrown planthopper (BPH), Nilaparvata lugens (Stål), is a rice-feeding insect distributed around tropical regions, with outbreaks continuing in Thailand. BPH destroys rice phloem, causing reduced yields. However, rice plant’s immune system and defence-related genes can protect the rice plants from BPH infestation (Senthil-Nathan et al, 2009; Jannoey et al, 2015).Innate immunity of rice plants is a complex system triggered by various elicitors. Defence mechanisms called herbivore-associated molecular patterns (HAMPs) are activated when herbivore makes contact with the plant’s host cell (Muthamilarasan and Prasad, 2013; Stael et al, 2015). HAMPs include insect saliva components, such as glucose oxidase, alkaline phosphatase, carliferins, volicitin, bruchins, pectinase and other proteinaceous elicitors (Cheng et al, 2013). Another elicitor, called damage-associated molecularpattern (DAMP), is released from damaged tissues, including plant cell wall polysaccharide, cutin monomer and endogenous peptides (Mott et al, 2014). All elements of this innate immune system have been found to respond to pathogens via pattern recognition receptors (PRRs), which are called PRR-triggered immunity (PTI). Effector-triggered immunity (ETI) is the second phase of innate immunity (Cheng et al, 2013). ETI can induce changes in the host cell’s structure, such as reducing aphid nymph production and increasing aphid fecundity. Previous reports suggest that there is an effector in BPH saliva that suppresses stress responses in rice cells (Muthamilarasan and Prasad, 2013). Salicylic acid (SA) and jasmonic acid (JA) are signaling compounds in plants to defend against microbial or insect attacks, as well as regulating growth, morphological change and biochemicalReceived: 1 August 2016; Accepted: 17 October 2016Corresponding author: Panatda J ANNOEY (kek_biotech@)Copyright © 2017, China National Rice Research Institute. Hosting by Elsevier B VThis is an open access article under the CC BY-NC-ND license (/licenses/by-nc-nd/4.0/) Peer review under responsibility of China National Rice Research Institute164 Rice Science, V ol. 24, No. 3, 2017processes (You et al, 2011; Qiu et al, 2014). Moreover, JA, SA, ethylene (ET), Ca2+, OsRac GTPase hormone signaling pathways and mitogen-activated protein kinase (MAPK) cascades may activate a basal resistance network in rice plants attacked by BPH (Cheng et al, 2013).The basal resistance model of rice immune response activates until BPH use their stylets to suck rice phloem sap through cell membrane, with saliva secreted during infestation. After BPH infestation, Ca2+ induced H2O2 accumulation, protein plugging, callose deposition, volatile compounds and hormone signaling pathways on the sieve plate induce resistance to BPH (Cheng et al, 2013). The effectors and elicitors from BPH saliva including HAMP and DAMP trigger the PTI system, subsequently inducing the SA, ET and MAPK cascade signaling pathways and volatile compound emission. These volatile compounds act as a repellent to BPH. However, effectors from BPH saliva are only recognized by BPH-resistant proteins in resistant varieties, resulting in BPH tolerance varieties.Another mechanism of rice’s response to BPH is based upon enzymes related to phenylpropanoid pathways and oxidative enzymes. Phenylalanine ammonia lyase (PAL), chalcone synthase (CHS) and lipoxygenase (LOX) are involved in phenolic compounds, while phytoalexin and lignin biosynthesis increase the plant’s resistance to pathogens. Oxidative enzymes, such as peroxidase (POD), polyphenol oxidase (PPO), superoxide dismutase (SOD) and catalase (CAT), also contribute to strengthening plant cell wall structures to increase resistance to pests. The activities of SOD, POD, CAT, PAL and PPO increase in resistant varieties after BPH infestation, which coordinates to the pathogen resistance (Hao et al, 2011; Duan et al, 2014).Moreover, pathogenesis-related proteins (PR proteins) and signaling molecules from SA, JA and ET also activate plant defences against pathogens or insects. PR proteins accumulate in the infected tissue in response to pathogens and stress, which can protect plants from pathogens and further infection (Ebrahim et al, 2011). PR proteins are categorized into 17 families depended on their properties and functions, including antifungal protein (PR1a), β-1,3-glucanase (PR2), chitinase (PR3, PR4, PR8 and PR11), thaumatin- like proteins (PR5), protease inhibitor (PR6), endoprotease (PR7), POD (PR9), ribonuclease (PR10), defensin (PR12), thionin (PR13), lipid-transfer protein (PR14), oxalate oxidase (PR15 and PR16) unknown (PR17) and the other type is phenylalanine ammonia lyase (PRpha) (Ebrahim et al, 2011). Previous reports found that PR1a may play a role in protecting against both rice stripe viruses and small brown planthopper (sBPH), but PR4 and PR10a only defend against sBPH infestation in resistant rice varieties (Hao et al, 2011). PR2 may be involved in the response to rice stripe viruses and sBPH in susceptible varieties (Zhang et al, 2004; Hao et al, 2011).The expression of genes resistant against BPH is one of the vital mechanisms in rice (Zhang et al, 2004; Du et al, 2009). Bph14, encoding a coiled-coil, nucleotide-binding and leucine-rich repeat protein, which is known as an immune receptor in BPH resistance, was latest isolated and characterized (Du et al, 2009; Zheng et al, 2013). This finding provides the molecular basis for rice resistance to BPH. Callose synthesis genes are up-regulated when BPH is feeding, subsequently inducing callose deposition (Zheng et al, 2013). Other genes, such as PR1a, PR4, PR10a, PR1b, PR2, CHS and LOX (Hao et al, 2011; Duan et al, 2014), PAL, EDS, NPR1 and PAD4 (Zhang et al, 2004), were compared in susceptible and resistant varieties using qRT-PCR. Moreover, northern blot and cDNA array analyses were employed to create expression profiles for cDNA clones of 108 genes that play a role in rice resistance to BPH. However, previous data shows the adverse results on expression level of some important genes. For example, PRpha is down-regulated in B5 resistant varieties (Zhang et al, 2004) but up-regulated in other studies (Hao et al, 2011; Duan et al, 2014). CHS rapidly increase in resistant varieties during BPH feeding compared with susceptible varieties (Hao et al, 2011), but no difference was found in other studies.In fact, since SA, ET and JA are required for defence against pathogens and insects (Duan et al, 2014), the adverse effects show that the JA synthesis-related genes reduce expression in resistant varieties infested with BPH (Zhang et al, 2004). Several studies have shown that the expression of PR2 does not differ between susceptible and resistant varieties (Zhang et al, 2004; Hao et al, 2011), although PR2 synergize with PR3 to defend against pathogens (Ebrahim et al, 2011). To clarify these previous findings, we studies differential expression of genes involved in pathogenesis response, signaling and lignin biosynthesis-related genes and antioxidant defence-response in rice using quantitative real-time PCR (qRT-PCR). Rice resistantPanatda J ANNOEY, et al. Rice Response Related Gene Expression Against BPH 165 to BPH was used to analyse expression levels afterBPH infestation and rice plants without BPHinfestation served as a control. Inducing defence geneexpression during rice-BPH interaction is required toenable better understanding of the mechanisms thatprotect rice against BPH.MATERIALS AND METHODSRice materials and BPH infestationAn indica rice variety PSL2 (Oryza sativa cv.Phitsanulok 2), resistant to BPH in Thailand, waschosen for this study. Rice seeds were provided by thePhitsanulok Rice Research Institute, Phitsanulok,Thailand. BPH populations were collected from thecountryside of rice fields in the sub-district ofPhitsanulok Province, Thailand, and maintained onTaichung Native 1 (TN1) in a cage until laying their eggs. Experimental rice plants were grown following the methods of Jannoey et al (2015) with modifications. The pregerminated rice seeds were planted in a pottery box and placed in a greenhouse cage at a water depth of 3.5 cm. After 10 days sowing, rice seedlings were infested with BPH nymphs at a ratio of 12 insects per seedling (Fig. 1). The dead rice seedlings were recorded, and mortality percentages were calculated, converting to 0–9 score scale following the standard of the International Rice Research Institute (IRRI, 1996). At 14 d after infestation, rice samples were collected for RNA extraction. Rice without BPH infestation was used as a control. The experiment was replicated three times. RNA extraction and cDNA synthesisA total of 100 mg rice samples were extracted using the RNeasy® Plant Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, then quantified using a NanoDrop ND-100 spectro-photometer.RNA was converted to cDNA using the Prime-Script First Stand cDNA Synthesis Kit (TaKaRa, Shiga, Japan). cDNA synthesis reactions were incubated at 37 ºC for 15 min and 85 ºC for 5 s. cDNA will be obtained and then amplified in a further step. Quantitative real-time PCR (qRT-PCR) Quantitative real-time PCR was performed with Thermal Cycle Dice Real-Time System II (TaKaRa, Shiga, Japan) with SYBR premix ExTag II (TaKaRa, Shiga, Japan). Primers were designed using the Primer 3 software according to the gene sequences in the GenBank Database. The specific primer pairs are shown in Table 1. The PCR reaction was carried out in triplicate in 96-well plates. The mixture contained 12.5 µL SYBR premix ExTag, 1 µL of 60 ng cDNA as the template, 5 µL of 2 µmol/L Primer premix and 6.5 µL DNase free water for a total volume of 25 µL. The thermal profile of the real-time system was one step at 95 ºC for 30 s, followed by 40 cycles at 95 ºC for 5 s (denaturation) and at 60 ºC for 30 s (annealing and extension) followed by added dissociation pattern. The actin gene was used as an internal standard.Data analysisRelative expression levels were determined using the average cycle threshold (CT). Average CT values were calculated from the triplicate experiment conducted for each gene, with the ∆CT value determined by subtracting the average CT value of genes from the CT value of actin gene. Finally, the equation 2-∆∆CT was used to estimate relative expression levels. Standard deviation was calculated from the replicated experimental data. The statistical analysis was conducted through the Tukey’s test at the 0.05 level.RESULTSExpression of pathogenesis-related genesTo assess the expression profile pathogenesis genes, qRT-PCR analyses were carried out. Pathogenesis-related genes including PR1a, PR2, PR3, PR4, PR6, Fig. 1. Hopperburn symptom of rice plants.A, PSL2 (resistant variety) attacked by brown planthopper (BPH) for 14 d; B, Control without BPH inoculation;C,TN1 (susceptible variety) in the cage condition; D, BPH nymph behaviors settled on the rice seedling stem.A BC D166 Rice Science, V ol. 24, No. 3, 2017The levels of relative expression were 1.04-, 1.12-,1.20-, 1.81-, 3.67-, 8.17-, 9.88-, 12.74-, 14.70- and 19.17-fold in rice plants infested with BPH compared to the control plants for PR2, PR13, PR1a , PR3, PRpha , PR4, PR10a , PR15, PR9 and PR6, respectively (Fig. 2). The highest increasing rate of the relative expression level was for the PR6 gene. PR4, PR10a and PRpha underwent a moderate change after BPH infestation, while PR1a , PR2, PR3 and PR13 showed no difference in the relative expression level between the infested rice plants and the control. Since there was no significant increase of the relative expressionlevel in the PR2 gene after BPH feeding, PR2 cannot play a role in defence-response to BPH in rice. Expression of antioxidant genesA total of four genes related to antioxidant enzyme biosynthesis were studied in this study. Reactive oxygen species (ROS) and various stressors can activate antioxidant defence systems in plants (Hao et al, 2011). Piercing and sucking by BPH was found to induce ROS accumulation and subsequent the expression of antioxidant defence genes, especially CAT and glutathione S -transferase gene (GST ), whileTable 1. Primers for qRT-PCR amplification designed by primer3 software. FunctionGene Protein nameForward primerReverse primerPathogenesis related-gene PR1a SCP-like extracellular protein GGAAGTACGGCGAGAACATC GGTCGTACCACTGCTTCTCC PR2 Glucanase TGCTATGTTCGACGAGAACG GTTGAACAGCCCAAAGTGCT PR3 Chitinase CTCACCACGAACATCCTCAC GTCGCAGTAGCGCTTGTAGA PR4 Chitinase CCGTCTTCTCCAAGATCGAC TGGTAGTCGACGATGAGGTG PR6 Protease inhibitor GTGCATCTTGCATGCTTTGT TTTTCCTCATGGTCCACACA PR15 Oxalate oxidase4 AGGCCTTCTGCAACAAGATG CACTCCTTCACCTCGTCCAT PR9 Lignin-forming peroxidase GATGGTGAAGATGGGGAACA ACGGAGCACTTGATCCTGAC PR10a Ribonuclease GCCGAATACGCCTAAGATGA ACATTTCTGCGGCTCTCATT PR13 Thionin CCGCTTCTGTACCAAGGAAG ATGTGTGAAGCCCCTTATGCPRpha Phenylalanine ammonia lyase AGAATCACCGAGTGCAGGTC GCCGGTCAGGTACTTTGTTC Lignin synthesis CHS Chalcone synthase AGGGAAGAATGGGGACTGAT TGCCTCGAACTAGCATTCCT CHI Chalcone isomerase AGCTCCTGAAGGCGGAAT GATTTTCACGCGGACACCC4H Cinnamate-4-hydroxylase CTCGTCCAGAGCTTCGACCT GGATCTGGTTGCTGAACTGG Signaling pathway LOX Lipoxygenase GGAGGTTCAACGAGAGGATG GATCCTTGTTCCGGCAGTC AOS Allene oxide synthase GGAGGAAGCTGCTGCAATAC TGCTTGTTGTCAACGCTAGG AXR Auxin responsive protein TGTTCCATGGGAGATGTTCA CCAATTGCATCTGAGCCTTTACO ACC oxidase CCTACCCGAGGTTCGTGTT CTCCTTGGCCTCGAACTTGT Oxidative stress SOD Superoxide dismutase CGATCCTGATGATCTTGGAAA CAGCCTTGAAGTCCGATGAT CAT Catalase AGGCAAGATCGTTTTCTCCA GCGACCAGTAGGAGATCCAG TRX Thioredoxin1 GACAGCTGCATGGAGTTCCT CCCTGATGAAGAGGAAGGTGGST Glutathione transferase GTAGGCTCGCCGAGTACG CAGCTGCTGCCCACTCTG ControlActinATCACCATCGGAGCAGAAAG AAAAGATGGCTGGAAGAGCAFig. 2. Differential expression of pathogenesis-related genes in rice response to brown planthopper (BPH) (Mean ± SD, n = 3).R e l a t i v e e x p r e s s i o n l e v e l R e l a t i v e e x p r e s s i o n l e v e lPanatda J ANNOEY , et al. Rice Response Related Gene Expression Against BPH 167SOD and TRX1 genes were down-regulated in rice during BPH infections (Fig. 3).Expression of signaling compounds biosynthesis related genesAllene oxide synthase (AOS ), 1 aminocyclopropane- 1-carboxylic acid oxidase (ACO ), LOX and auxin responsive gene (AXR ), which involve in signaling compounds biosynthesis pathway, were also investigated in rice after BPH infestation. AXR showed down-regulated expression (Fig. 3), indicating that auxin hormones have no effect on rice resistance to BPH. LOX showed no significant difference in the relative expression level, while ACO examined moderately increased relative expression level in infested rice. Interestingly, AOS showed dramatically increasing rate in relative expression level among the signaling compound biosynthesis related genes.Expression of lignin biosynthesis-related genes Lignin accumulation is required in rice to defend against BPH (Jannoey et al, 2015). Thus, lignin and phenolic compound biosynthesis related genes were investigated, including cinnamate-4-hydroxylase (C4H ), CHS and chalcone isomerase (CHI ), the major genes involved in lignin biosynthesis (Fig. 4). CHS and C4H genes, encoding key enzymes for lignin biosynthesis, were up-regulated at 1.51-fold and 4.38-fold respectively upon infestation with BPH. There was no change in CHI genes which is related to phenolic compound biosynthesis (P = 0.96).DISCUSSIONExpression of pathogenesis-related genesPR genes protect plants against pathogens byFig. 3. Differential expression of antioxidant enzyme-related genes (SOD , CAT , TXR1 and GST ) and signaling compound biosynthesis-relatedgenes (AXR , ACO , AOS and LOX ) in rice response to brown planthopper (BPH) (Mean ± SD, n = 3).Data were analyzed at the 0.05 level. The blank columns are control rice plants and the black ones are rice plants infested with BPH.SOD CAT TRX1 GSTAXR ACO AOS LOXR e l a t i v e e x p r e s s i o n l e v e l R e l a t i v e e x p r e s s i o n l e v e lFig. 4. Differential expression of lignin biosynthesis-related genes in rice response to brown planthopper (BPH) (Mean ± SD, n = 3).CHI CHS C4HR e l a t i v e e x p r e s s i o n l e v e l168 Rice Science, V ol. 24, No. 3, 2017accumulating in areas around infected tissue (Ebrahim et al, 2011). Among these, the relative expression levels of PR6, PR9 and PR15 were higher than those of the other PR genes, which may indicate these genes play an important role in defending against BPH attacks in rice.PR6 encodes protease inhibitor proteins, such as trypsin inhibitors, which are wound-response pathogen proteins. It is found in chewing insects and some nematodes and suppresses digestion in the larval midgut by inhibiting gut protease enzymes, as regulated by signal transduction pathways (Zhang et al, 2004; Cheng et al, 2013). Thus, PR6 plays an important role in plant defence responses to insect damage (Fig. 5). most dramatically in rice infected with BPH (P = 0.00). These results, along with previous reports, show that PR6 increases resistance by up to eight times in the event of BPH feeding (Zhang et al, 2004). BPH also induces expression of PR6 genes following BPH infestation in other reports (Weng et al, 2003; Du et al, 2009; Cheng et al, 2013), suggesting that PR6 gene can suppress BPH feeding on rice harbouring BPH-resistance genes (Cheng et al, 2013). In addition, the expression of trypsin inhibitor genes is enhanced in the transgenic rice, whereas the expression of PR6 gene is higher than that of other wound-response genes in rice-BPH infestations (Weng et al, 2003). Artificial diets supplemented with protease inhibitorsFig. 5. Schematic representation of brown planthopper (BPH) triggered rice defense mechanism (Cheng et al, 2013 with modifications).BPH induced the expression of wound-response genes in rice represented by following mechanism: (1) Wound-induced Ca2+ fluxes occur in rice as a second messenger. The rice CBL-interacting protein kinases (CIPK14 and CIPK15) are Ca2+-related-protein sensor and involve in induced accumulation of signaling molecule (ethylene and jasmonic acid). (2) H2O2 is emerging as signal molecules after wounding and subsequently Ca2+ accumulates. H2O2 activates jasmonic acid, and controls the expression of defense related-gene and metabolite biosynthesis. (3) Rice chitin elicitor-binding protein (CEBiP) is essential for chitin recognition for chitin-trigged immunity induction. Plants recognize pathogen by cell surface localized pattern-recognition receptor (PRRs). PRRs also interact with OSRAC1 for regulation of the final step of signaling pathway including the production of reactive oxygen species (ROS), lignin, PR proteins and mitogen-activated protein kinase (MAPK) cascade. (4) Damage-associate molecular pattern (DAMP) molecules are release from wound tissue, and activate the plant innate immunity. Oligogalactoronides (OGs), one of the DAMP molecules, involve in plant response to wounding. OGs can induce the protease inhibitor, ROS, nitrix oxide, phytoalexin, PR2 and PR3 accumulation, and callose deposition. However, OGs also regulate auxin-antagonistic activity.Ethylene signalingPanatda J ANNOEY, et al. Rice Response Related Gene Expression Against BPH 169fertility in insects (Jamal et al, 2015; Kuwar et al, 2015). PR6 can therefore be used in pest control for food crops, since the expression of PR6 may induce trypsin inhibitor production and interfere with BPH digestion during feeding on BPH-resistant rice. The piercing and sucking of BPH could induce PR6 expression, causing severe damage to rice plants.PR9, a lignin-forming POD enzyme, catalysing lignin deposition functions for plant cell wall strengthening (van Loon and van Strien, 1999), showed significantly increased (P = 0.00) activity in rice infested with BPH. Recently, the transcription level of PR9 in wheat is down-regulated significantly after infestation with the aphid-transmitted fusarium virus and Hessian flies in susceptible varieties (Wu et al, 2014). This suggests that PR9 plays a role in catalysing lignin deposition to defend against BPH in susceptible varieties. PR15 encodes the oxalate oxidase enzyme (Li et al, 2015) and has been found to be expressed at a higher rate of 12.74-fold among PR genes in rice infested with BPH. Oxalate oxidase plays a role in plant defence, with expression of oxalate oxidase boosting resistance to pathogens in rice (Zhang et al, 2013) and engineers rice plants with oxalate oxidase genes more resistant to sheath blight disease (Molla et al, 2013). PR1 includes PR1a, PR1b and PR1c. The role of PR1a in defending against BPH was investigated in this study, showing that the relative expression level of PR1a increased to 1.20-fold after BPH infection. However, there was no significant difference between the control and BPH-treated rice in transcript levels. Hao et al (2011) found the highest expression of PR1a in a resistant variety after 6 h of BPH feeding. PR1a also increases expression in rice containing the resistance gene Xa21 during bacterial leaf blight infections (Ponciano et al, 2006). Jwa et al (2001) reported that the expression levels of PR1a and PR10 increase in rice infected with Magnaporthe grisea. Therefore, the expression of PR1a may contribute more to rice plants’ defence against bacterial and fungal pathogens than BPH.PR2 encodes for 1,3-ß-glucanase throughout the plant kingdom (Simmon et al, 1994) and belong to the glycoside hydrolases family (Akiyama et al, 2009; Opassiri et al, 2010). 1,3-ß-glucanase hydrolyses the ß-O-glycosidic bond of ß-glucan in plant cell walls, with cell wall loosening and expansion (Akiyama et al, 2009). This phenomenon may be the cause of rice cell wall leakage during BPH infestations. PR2 is down-regulated in resistant rice varieties as a response to BPH-feeding and up-regulated in susceptible ones (Zhang et al, 2004). However, in this study, PR2 presented no difference in expression levels between the BPH-infested sample and the control (P = 0.85). Generally, the increased expression level of PR2 will activate callose hydrolysis in susceptible phloem cells during BPH attacks (Du et al, 2009; Hao et al, 2009; Cheng et al, 2013). Increased expression of PR2 also occurs when rice is infected with other pathogens (Sridevi et al, 2008), wounded (Opassiri et al, 2010) or in response to signaling molecules (Akiyama et al, 2009). Moreover, Akiyama et al (2009) have shown that the expression of PR2 increases when rice leaves are exposed to methyl jasmonate, abscisic acid, ethephon and mechanical wounding, which indicates that PR2 may not promote callose hydrolysis in resistant varieties, despite resistant varieties being shown to survive BPH attacks in this study. PR2 gene is not considered to be part of the defence mechanism in rice to defend against BPH in this study. Sridevi et al (2008) suggest a combination of PR2 and PR3 genes in indica rice will enhance resistance to Rhizoctonia solani. Other transgenic plants containing PR2 and PR3 genes, such as tobacco (Nishizawa et al, 2003), carrots (Melchers and Stuiver, 2000) and wheat (Anand et al, 2003), show enhanced resistance to Cercospora nicotianae (Zhu et al, 1994), R. solani (Jach et al, 1995) and F. oxysporum (Jongedijk et al, 1995).PR3 and PR4 encode chitinase enzymes known as defence enzymes (Xi et al, 2015). Chitinase is normally found in a range of organisms, including fungi, viruses, bacteria, insects and rice (Xayphakatsa et al, 2008). In rice, chitinase levels are higher in PTB33 (a resistant variety) than TN1 (a susceptible variety) after infestation for 3 d (Alagar et al, 2007). Previous research indicates that rice chitinase has an important role in hydrolysing chitin, a major structural component of the gut lining and cuticle of insects and in the cell walls of many fungi and the egg shells of nematodes (Alagar et al, 2007). Furthermore, PR3 chitinase is known to inhibit fungal growth both in vitro and in vivo. Therefore, PR3 plays a role in protecting plants from pathogen infestations (Xayphakatsa et al, 2008). Many plants have been developed for fungal resistance via inducing chitinase (PR3) and glucanase (PR2) production. The combination of PR3 and PR4 protects rice plants against many fungal diseases (Sridevi et al, 2008). However, the transcription level of PR3 in this study was lower compared to the control and among PR genes,170 Rice Science, V ol. 24, No. 3, 2017suggesting PR3 did not respond to BPH infection. Similarly, a low level of antifungal activity produced by rice chitinase class III was found after fungal infection, because function of PR3 is as an elicitor, releasing than killing the invading fungi (Xayphakatsa et al, 2008; Ting and Chai, 2015).Expression of antioxidant genesBPH infection resulted in a significant decrease in both SOD and TRX genes, while the expressions of GST and CAT genes significantly increased (Fig. 3). CAT genes encode catalase enzymes, which are important for converting H2O2 to H2O and O2 in rice plant cells (Hao et al, 2009). H2O2 is an ROS, which damages nucleic acids, lipid oxidation and protein oxidation. ROS production in plants is an early response mechanism after oxidation. Increased expression of CAT genes may be required for detoxification in plant cells after BPH infestations, specifically by inhibiting accumulation of ROS to protect rice plants from oxidative stress, such as BPH feeding.The expression of GST genes also increased after BPH feeding. These genes encode GST enzymes. In plants, GST reduces H2O2 after biotic and abiotic stress. It can remove toxic compounds and reduce peroxides, as well as increase cellular detoxification and oxidative tolerance (Gill and Tuteja, 2010). The aeration of H2O2 concentration in damaged cells can activate CAT and GST genes. Increased GST transcription levels have also been found in barley under drought stress among tolerant varieties (Rezaei et al, 2013). It has also been found that transgenic Arabidopsis harbouring GST gene show enhanced resistance to salt and drought (Xu et al, 2015). Additionally, significant increases in GST gene expression have been observed in transgenic rice, enhancing tolerance to chilling, salinity, copper, cadmium and herbicide treatment (Hu, 2014). These results indicate that CAT and GST genes (P = 0.00) are related to BPH response in rice.SOD and TRX1 genes were down-regulated in this study. SOD genes catalyse the superoxide radicals (O2–) into H2O2, while TRX1 genes are involved in detoxification of lipid hydroperoxides to protect against oxidative stress in plant cells (Vieira and Rey, 2006). This suggests that the damage to rice cells from BPH may induce the H2O2 than O2– accumulation. Expression of signaling compounds biosynthesis related genes biosynthesis, using linoleic acid as the substrate. LOX enzymes catalyse oxygenation of fatty acids to their hydroperoxy derivatives in JA biosynthesis pathways (Turner et al, 2002). There was no significant difference in LOX gene expression between BPH-infested rice and the control sample (P = 0.53) (Fig. 3), suggesting that LOX has no effect on JA biosynthesis induced by BPH infestation.ACO genes or ACC oxidase enzymes catalyse the ACC substrate in the final step of ethylene biosynthesis (Iwamoto et al, 2010). AOS genes encode allene oxide synthase, the first enzyme in the branch pathway leading to JA biosynthesis, and are known to catalyse dehydration of 1,3-hydroperoxy-octa-decatrienoic acid to unstable epoxide. They are classified as wound-inducible genes (Turner et al, 2002). The results showed that ACO genes (P = 0.00) underwent moderate increases in the relative expression level compared to the control at 2.76-fold, whereas AOS genes expressed at 24.38-fold (Fig. 3). Previous research suggests ACO genes are wound responsive and subsequently activate AOS genes in JA biosynthesis. Therefore, rice defends against BPH by inducing AOS and ACO genes for JA production when cells are damaged.Expression of lignin biosynthesis-related genes There was no change in CHI and CHS genes which were related to phenolic compound biosynthesis (P = 0.96) (Fig. 4). This indicates that some phenolic compounds may not be involved in protecting rice against BPH. The transcription level of C4H genes increased moderately (P = 0.00), though more in resistant varieties than in the susceptible ones (Fig. 4). C4H encodes cinnamate-4-hydroxylase, key enzymes in phenylpropanoid pathways related to lignin biosynthesis (Duan et al, 2014). Lignin is the second natural polymer connected to cellulose and hemicellulose in plant cell walls. It composes of coniferyl, sinapyl and p-coumaryl alcohol of substituted phenol cross-linked macromolecule (Sun et al, 2013; Watkins et al, 2015). Duan et al (2014) reported that expression of PRpha in resistant varieties is also higher than in a control after 12 h BPH infestation. PRpha and C4H genes may combine with PR9 genes to form lignin in resistant varieties.CONCLUSIONSWound-inducible genes (AOS, PR6, PR9 and PR15)。